ID: 966897435

View in Genome Browser
Species Human (GRCh38)
Location 3:184456372-184456394
Sequence AGTCCAGGTTGGGCACCGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 106}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966897430_966897435 -8 Left 966897430 3:184456357-184456379 CCCAGAAAAGGGCTCAGTCCAGG 0: 1
1: 0
2: 3
3: 26
4: 236
Right 966897435 3:184456372-184456394 AGTCCAGGTTGGGCACCGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 106
966897425_966897435 18 Left 966897425 3:184456331-184456353 CCAGGCACATCCTTGGGGATCCT 0: 1
1: 0
2: 0
3: 14
4: 180
Right 966897435 3:184456372-184456394 AGTCCAGGTTGGGCACCGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 106
966897426_966897435 8 Left 966897426 3:184456341-184456363 CCTTGGGGATCCTTGTCCCAGAA 0: 1
1: 0
2: 1
3: 11
4: 180
Right 966897435 3:184456372-184456394 AGTCCAGGTTGGGCACCGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 106
966897424_966897435 19 Left 966897424 3:184456330-184456352 CCCAGGCACATCCTTGGGGATCC 0: 1
1: 0
2: 0
3: 12
4: 135
Right 966897435 3:184456372-184456394 AGTCCAGGTTGGGCACCGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 106
966897429_966897435 -2 Left 966897429 3:184456351-184456373 CCTTGTCCCAGAAAAGGGCTCAG 0: 1
1: 0
2: 3
3: 19
4: 307
Right 966897435 3:184456372-184456394 AGTCCAGGTTGGGCACCGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 106
966897432_966897435 -9 Left 966897432 3:184456358-184456380 CCAGAAAAGGGCTCAGTCCAGGT 0: 1
1: 0
2: 2
3: 13
4: 154
Right 966897435 3:184456372-184456394 AGTCCAGGTTGGGCACCGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966897435 Original CRISPR AGTCCAGGTTGGGCACCGTC AGG Intronic
900387329 1:2416596-2416618 AGCCCTGGGTGGGCACAGTCAGG + Intergenic
900929263 1:5726064-5726086 AGTCCAGGGTGGCCACACTCAGG - Intergenic
902224058 1:14985329-14985351 AGACCAGGTTGGGCAACATAGGG + Intronic
902773895 1:18662025-18662047 AGACCAGGTTGTGCTCAGTCAGG - Intronic
904208231 1:28868921-28868943 AGTCCAGGCTGGGCACCTGCTGG + Intergenic
905003188 1:34689516-34689538 AGCCCAGGTTGGGCAGCATGTGG + Intergenic
906094943 1:43216530-43216552 AAGCCAGCTTGGGCACCTTCAGG - Intronic
915311977 1:155009517-155009539 GGTCCAGGGTGGGCACCCTCCGG + Intronic
924450941 1:244178443-244178465 ACTCCAGCTTGGGCAACGGCGGG + Intergenic
1062829786 10:597960-597982 AGTCCAGGTAGGGAACCGTGGGG - Intronic
1067440530 10:46306915-46306937 AGTCAGGGTTGGGCACCTTGAGG + Intronic
1067896578 10:50187424-50187446 ATTCCAGGCTGGGCAGTGTCTGG + Exonic
1067952394 10:50754609-50754631 ATTCCAGGCTGGGCAGTGTCTGG - Exonic
1068897871 10:62227577-62227599 AGTCCTGGTGGGGCACGGTAAGG + Intronic
1069807494 10:71135021-71135043 AGGCCAGGGTGGGCAGCATCTGG + Intergenic
1070594659 10:77824182-77824204 AGGCCATGTTGGGCACAGTTGGG - Intronic
1072792798 10:98330641-98330663 ACTCCCGGATGGGCACCGTATGG + Intergenic
1075693347 10:124416249-124416271 AGCCCAGGTTGGGCATCCTGTGG + Intronic
1077500895 11:2909376-2909398 AGTCCAGGTGGGGCCGGGTCGGG + Intronic
1078334131 11:10450758-10450780 CGCCCAGGTAGGGCACCGACGGG + Exonic
1085363156 11:75911320-75911342 AGTCAAGGCTGGGCACCTTTGGG - Intronic
1089375962 11:117994808-117994830 AGTCCAGTGTGGGCAGAGTCTGG + Intronic
1089568522 11:119386443-119386465 AGTCCAGCTTGGGCAACATAGGG + Intergenic
1091228763 11:133974348-133974370 AGGCCAGGTTGAGCCCCGCCCGG + Intergenic
1091379966 12:51249-51271 AGACGAGATTGGGCACCCTCAGG + Intergenic
1093425510 12:19024034-19024056 AGCCCAGACTGGGCACCCTCTGG + Intergenic
1096264621 12:50113071-50113093 AGACCAGGTTGGGCAACATAGGG - Intronic
1097115182 12:56691746-56691768 AGTCCAGCCTGGGCAACGTAGGG + Intergenic
1097678069 12:62623881-62623903 AGACCAGCTTGGGCAACGTAGGG + Intergenic
1098570275 12:71980472-71980494 AGTCCAGGTAGGTCCCTGTCAGG + Intronic
1100281874 12:93126047-93126069 AGACCAGTTTGGGCACCATAGGG + Intergenic
1101985577 12:109443941-109443963 AGTCCAGGCTGGGCAACGCTAGG - Intronic
1101985817 12:109446238-109446260 AGCCCAGCATGGGCACAGTCAGG - Intronic
1102114033 12:110387812-110387834 AGTCCAAGTTAGGCACGGTTTGG + Exonic
1102824780 12:115939837-115939859 AGTCCAGCTTGGGCAACATAAGG + Intergenic
1103219398 12:119231273-119231295 AGCCCAGGTGTGGCACAGTCAGG + Intergenic
1109716581 13:66228920-66228942 TGTACAGGTTGGGCACCACCGGG + Intergenic
1112609846 13:100945618-100945640 AGCCCAGGTTGAGGACTGTCGGG - Intergenic
1119309636 14:73635005-73635027 AGACCAGGCTGGGCAACGTAGGG - Intergenic
1127068561 15:55265651-55265673 AGACCAGGTTTCGAACCGTCAGG + Intronic
1129602245 15:77006992-77007014 AGTCCAGGCTGGGCAAACTCAGG - Intronic
1132467235 16:82977-82999 GGTCCAGGCTGGGCACTGTTAGG + Intronic
1132891313 16:2206190-2206212 AGTCCTGGTGCTGCACCGTCCGG - Exonic
1133056293 16:3147150-3147172 AGGCCAGGTGGGGCAGGGTCTGG + Intronic
1133658184 16:7887537-7887559 AACCCAGGTTGTGCACCCTCTGG + Intergenic
1137462212 16:48675329-48675351 AGACCAGCTTGGGCAACGTAGGG + Intergenic
1139906236 16:70367975-70367997 AGACCAGCCTGGGCAACGTCGGG + Intronic
1141524336 16:84602081-84602103 AGTACATGTGGGGCATCGTCTGG - Intronic
1144841401 17:18188608-18188630 AGTCAGGGCTGTGCACCGTCAGG + Intronic
1151425533 17:74028810-74028832 CGTGCAGGATGGGCACCCTCTGG + Intergenic
1152214618 17:79024970-79024992 GGTCCAGGTTGGCCACAGACAGG - Intronic
1152768271 17:82152508-82152530 AGTCCAGGTTGGGCTGAGTGAGG - Intronic
1155764384 18:29609081-29609103 AGACCAGGTTGGGCAACATATGG + Intergenic
1160507137 18:79433579-79433601 AGTCCAGGGCGGGCAGGGTCGGG - Exonic
1161088179 19:2344564-2344586 AGTTCAGCCTGGGCACCTTCAGG - Exonic
1161680143 19:5676039-5676061 AGTCAGGGTTGGGGACCCTCAGG + Intronic
1162547653 19:11340131-11340153 AGACCAGCTTGGGCATCGTAAGG + Intronic
1162926530 19:13933073-13933095 AGGCCAGGTTAAGCTCCGTCAGG + Exonic
1163736351 19:18983601-18983623 AGTCCAGGGTGGGCACCCGGGGG - Intergenic
1164557620 19:29265847-29265869 ACTCCAGATTGTGCACTGTCTGG + Intergenic
1166130525 19:40743131-40743153 AGGCCAGGTTGGTCCGCGTCAGG - Intronic
1166991083 19:46693187-46693209 AGTCCAGGGTGGGCAGGGTTGGG - Intronic
1167113148 19:47473655-47473677 AGTCCTGGCTGGACACCGTCAGG + Intergenic
925865270 2:8221443-8221465 AGTCCAGGAGGGGCACAGTGTGG - Intergenic
936563906 2:113567595-113567617 AGACGAGATTGGGCACCCTCAGG - Intergenic
938294566 2:130169748-130169770 AGACCAGTGTGGGCAACGTCGGG - Intronic
946411018 2:219515159-219515181 AGACCGGGATGGGCACCGTGCGG + Exonic
1171371420 20:24664731-24664753 TGTCCAGGGTGGGGACGGTCAGG + Intronic
1172225260 20:33301292-33301314 TGTCCAGGGTGGGCATTGTCAGG - Exonic
1173178504 20:40783696-40783718 AGACAAGGTTGGGCACCCACTGG - Intergenic
1175530582 20:59672081-59672103 TGGGCAGTTTGGGCACCGTCTGG + Intronic
1175752442 20:61508694-61508716 ATTCCAGGTGGGGCAGCGCCTGG - Intronic
1179423379 21:41253646-41253668 AGTCCAGGTGGGTCACAGCCGGG + Intronic
1185418240 22:50721318-50721340 AATCCAGGCTGGGCTCCGTGGGG - Intergenic
952776507 3:37051775-37051797 AGCCCAGGTGGGGCACAGGCTGG + Intergenic
953429714 3:42829201-42829223 AGTCCACGTTTGCCACCTTCTGG - Intronic
954311432 3:49771297-49771319 AGTCCAGCTTGGGCAACATAGGG + Intronic
956298325 3:67738916-67738938 AGTCCAGCTTAGCCACCATCTGG + Intergenic
956712154 3:72048322-72048344 AGGCCAGGAGGGGCACTGTCAGG + Intergenic
966497769 3:180600606-180600628 AGTCCAGCTTGGGCGCCGGAGGG - Intergenic
966897435 3:184456372-184456394 AGTCCAGGTTGGGCACCGTCAGG + Intronic
968265242 3:197357772-197357794 AGACAAGATTGGGCACCTTCAGG + Intergenic
968439781 4:617435-617457 AGTCCAGTTTGGGCAATGGCAGG + Intergenic
979660136 4:123243816-123243838 AGACCAGCCTGGGCACCGTAGGG + Intronic
985559807 5:579266-579288 AGTCCAGGATGGGGAGTGTCAGG + Intergenic
985842691 5:2320628-2320650 AGACCAGGCTGGGCAACGCCAGG - Intergenic
990451589 5:55936268-55936290 AGTGCAGGGTGGGCACAGACAGG + Exonic
991632147 5:68666875-68666897 AGCCCAGGGTGGGCACAGTCGGG - Intergenic
997178625 5:131804786-131804808 AGACCAGGTTGGGCAACGTAGGG - Intergenic
998968174 5:147563213-147563235 AGTCCAGGCTGGGCAACATCAGG - Intergenic
999143411 5:149377645-149377667 AGTCCAGGATGGGCCCATTCAGG + Intronic
999894648 5:156017959-156017981 AGACCAGCCTGGGCACCGTAGGG + Intronic
1000665632 5:163992964-163992986 AGTTCAGGTAGGGCACAGTGGGG + Intergenic
1002199877 5:177521698-177521720 AGTCCAGGAAGGGGACCTTCAGG + Intronic
1003624684 6:7729901-7729923 AGTCCAGCCTGGGCAACGTTGGG - Intronic
1005515994 6:26554720-26554742 GGTCCAGGTTGGCCAACGCCGGG + Intergenic
1006035189 6:31205925-31205947 CGTCCAGGCTGTGCACTGTCTGG + Intergenic
1009036662 6:58125072-58125094 CATCCAGGCTGGGCACCGTGGGG - Intergenic
1012703555 6:102494102-102494124 AGTCCAGGCTGTGCAATGTCTGG + Intergenic
1013116084 6:107104861-107104883 AGACCAGCTTGGGCAACGTAGGG - Intronic
1019435706 7:1021109-1021131 ACTCCAGGTTGGGAACCTCCAGG + Intronic
1020269341 7:6583870-6583892 AGACCAGCTTGGGCACCATGGGG + Intronic
1021758883 7:23883884-23883906 AGACCAGGCTGGGCAACGTGGGG - Intergenic
1028808914 7:95061535-95061557 AGACCAGGCTGGGCAACGTAGGG + Intronic
1031991254 7:128200776-128200798 AGTCCAGGCTGGGCAGCATAGGG + Intergenic
1032078941 7:128849134-128849156 AGCCCACGTTGAGCACCGCCTGG + Intronic
1034925125 7:155115117-155115139 AGTCCAGCTTGGGCAACATTGGG - Intergenic
1037577669 8:20223327-20223349 ATTCTAGGTTAGGCACCCTCAGG - Intronic
1050225689 9:3452390-3452412 AGTCCAGCTTGGGCAACATACGG + Intronic
1055038599 9:71844918-71844940 AGTCCAGGGTGGGAATGGTCAGG - Intergenic
1060883501 9:127134928-127134950 AGTCCAAGATGGGCACTGTGGGG + Intronic
1062119793 9:134828073-134828095 AGTCCAGGCTGGGGACAGGCCGG + Intronic
1186020685 X:5251597-5251619 AGTCCAGGTTGTGCCCCATCAGG + Intergenic
1200060533 X:153481844-153481866 ACTCCAGGTTGGGCAGCCCCAGG - Intronic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic