ID: 966898719

View in Genome Browser
Species Human (GRCh38)
Location 3:184465136-184465158
Sequence GCAGCCCGGAGCCTCTATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966898719 Original CRISPR GCAGCCCGGAGCCTCTATGG GGG (reversed) Intronic
901867531 1:12116889-12116911 CAAGCCCAGAGCCTCTCTGGGGG - Intronic
903170297 1:21548244-21548266 GCAGCCAGGAGCCTCTGCGAGGG + Intronic
904227848 1:29039405-29039427 GCGTCCCGGAGCCTCGATGGAGG + Exonic
905099816 1:35509889-35509911 GCAGCAAGGAGCCTGGATGGAGG + Intronic
919685982 1:200484002-200484024 GCAGCCTGGAGCCTCCAGGTGGG - Intergenic
920294439 1:204947244-204947266 GCAGCCGGGGGCCTCTCTGAAGG - Intronic
921276863 1:213529287-213529309 GGAGCATGGAGCCTCCATGGTGG + Intergenic
1066428141 10:35327848-35327870 CCAGCCAGGAGCCACCATGGAGG - Intronic
1070319609 10:75344561-75344583 GCAGCCATCAGCCTCTATGAAGG + Intergenic
1072987899 10:100158031-100158053 GGAGCCGAGAGCCTGTATGGTGG + Intronic
1076268852 10:129132934-129132956 GCCGCCGGATGCCTCTATGGCGG - Intergenic
1076554384 10:131312030-131312052 GGAGCCCGGAGCCTCCCTCGCGG - Intergenic
1076719044 10:132384947-132384969 AGAGCCCTGAGCCTCCATGGAGG - Intergenic
1085708630 11:78809517-78809539 GCATCCTGGAGCCTCTGGGGTGG + Intronic
1087063261 11:94003672-94003694 GCAGCACGGAGCCATGATGGAGG + Intergenic
1098488624 12:71049903-71049925 GCAGCCCCTGACCTCTATGGGGG + Intronic
1107283179 13:38759396-38759418 GCAGCCCTGAGCTTTTAGGGAGG + Intronic
1110347025 13:74460490-74460512 GAAGCCAGGTGCCTCTCTGGAGG - Intergenic
1110808895 13:79790744-79790766 GGAGCCCGGATCCACTAGGGTGG + Intergenic
1112208262 13:97347093-97347115 GCACCCCGGCGCCTCTGCGGAGG + Intronic
1113124129 13:106957735-106957757 GAAGCCCAGAGGCCCTATGGAGG + Intergenic
1118817418 14:69323279-69323301 GGAGCCAGGAGCCTCTAAAGGGG - Intronic
1121045050 14:90781767-90781789 CCAGCCCTTAGCCTCTAGGGAGG - Intronic
1121950523 14:98167387-98167409 GCAGGTGGGAGCCTCCATGGTGG - Intergenic
1124725242 15:32150729-32150751 GGAGCCCTGAGACCCTATGGAGG - Intronic
1128119245 15:65133574-65133596 GCAGCCCCGAGCCTCCGCGGAGG - Exonic
1128758684 15:70199996-70200018 ACAGCCCGGGGGCTCTCTGGGGG - Intergenic
1129543053 15:76366929-76366951 GCAGCCCTGAGACTCTGAGGTGG + Intronic
1131360619 15:91787539-91787561 GCAGCTCTGTGCCTCCATGGAGG + Intergenic
1131531777 15:93199932-93199954 GGAGCCCAAAGCCACTATGGTGG + Intergenic
1133125475 16:3643176-3643198 GCAGCCCTGAGCCCCTATCTTGG - Intronic
1136231612 16:28888868-28888890 GCAGCCCAGGGTCTCTACGGAGG - Exonic
1142178546 16:88656211-88656233 GCCTGCCGGAGCCTGTATGGGGG - Exonic
1145041319 17:19579996-19580018 AGGGCCCGGAGCCGCTATGGGGG - Intergenic
1146312384 17:31779211-31779233 CCAGCCTGGAGCCTCCATGCTGG - Intergenic
1149758754 17:59210158-59210180 GCGGACCGGAGCCTCCATGGCGG + Exonic
1150457227 17:65316428-65316450 GAAGCCCGGAGACTCTAGTGGGG - Intergenic
1152717287 17:81906200-81906222 TCAGCCCGGAGACTTTTTGGGGG + Intronic
1153473295 18:5469649-5469671 CCAGCCGGAAGCCTCTAGGGCGG - Intronic
1154139472 18:11810579-11810601 TCAGCCCGGAGCCTGCAGGGAGG + Intronic
1157590962 18:48836292-48836314 GCAGCCCAGGGCCTCTCTGGGGG - Intronic
1158199859 18:54927908-54927930 GCAGCAGGGAGCCTGTAGGGGGG + Intronic
1161341904 19:3747663-3747685 GGAGCCTGGAGCCTCAGTGGAGG - Intronic
1161403364 19:4078575-4078597 GCAGCCCGGAGCCTCCTTCCCGG - Intergenic
1161513503 19:4684220-4684242 GCAGCACAGGGCCTCTCTGGAGG + Intronic
1163635222 19:18434254-18434276 GCAGCCCCGGGCCTCTCTGCGGG + Exonic
1163691168 19:18739244-18739266 TCAGCCCCGAGCCTCTGTGTAGG + Intronic
1166375714 19:42325810-42325832 CCGGCCCGCAGCCTCTATGGAGG + Intronic
1166528168 19:43526305-43526327 GCAGCCCCGAGCCTGTAATGTGG + Exonic
1167742007 19:51329418-51329440 GAAGCCCAGAGCCTAGATGGAGG - Exonic
1168500098 19:56885706-56885728 GCAGCCCAGGGCCTCTATAAAGG - Intergenic
927851537 2:26503136-26503158 GCAGCCGGGAGCCCCGATGGTGG + Intronic
933599417 2:84314946-84314968 GGAGTCGGGAGGCTCTATGGGGG - Intergenic
933647879 2:84827070-84827092 CCAGCCCAGAGGCTCTATGATGG - Intronic
942515276 2:176746166-176746188 GCAGCTCGGAGCCTAGATGCGGG + Intergenic
942686159 2:178534271-178534293 GCAGCCCGGATCTCCTGTGGTGG - Exonic
946432316 2:219632296-219632318 GCAGCCAGGAGCCCCACTGGCGG + Exonic
1169278384 20:4248475-4248497 GAAGCCCAGAACCTCCATGGTGG + Exonic
1169445734 20:5669613-5669635 GGAGCCCACCGCCTCTATGGGGG + Intergenic
1173384836 20:42577665-42577687 GTAGCCCTGACCCTCTGTGGTGG - Intronic
1174134238 20:48367936-48367958 GCAGCCAGGAGCCTCCGAGGCGG + Intergenic
1174357965 20:50010614-50010636 CCAGCCCGGAGCTGCCATGGTGG + Intergenic
1176553637 21:8243083-8243105 CCGGGCCGGAGCCGCTATGGGGG - Intergenic
1176572559 21:8426107-8426129 CCGGGCCGGAGCCGCTATGGGGG - Intergenic
1176580468 21:8470668-8470690 CCGGGCCGGAGCCGCTATGGGGG - Intergenic
1179892830 21:44345550-44345572 GGAGCCCAGAGCCTCCAGGGTGG - Intergenic
1180090207 21:45530483-45530505 GCAGCCCGGGGCCTAGAGGGTGG + Intronic
1180795693 22:18603832-18603854 GCAGCCTGGGGAGTCTATGGAGG + Intergenic
1181226036 22:21391440-21391462 GCAGCCTGGGGAGTCTATGGAGG - Intergenic
1181252600 22:21543372-21543394 GCAGCCTGGGGAGTCTATGGAGG + Intergenic
1181646482 22:24233947-24233969 GCAGACCAGAGCCGCGATGGTGG + Exonic
1184529145 22:45043394-45043416 GCGGCCCTGAGCCTTTATGCAGG + Intergenic
1203258639 22_KI270733v1_random:160115-160137 CCGGGCCGGAGCCGCTATGGGGG - Intergenic
950260883 3:11542920-11542942 GCAGCCCTGAGCATCTTTGTAGG + Intronic
953686480 3:45082106-45082128 GTGGCCCTGGGCCTCTATGGGGG + Intergenic
961820336 3:129572649-129572671 GGAGCTCGGAGCCTACATGGAGG + Exonic
962448448 3:135490827-135490849 GCAGCAGGTAGCCTCTTTGGAGG + Intergenic
966182634 3:177200507-177200529 GCAGCCCTGATCCTTTATGCTGG - Intergenic
966898719 3:184465136-184465158 GCAGCCCGGAGCCTCTATGGGGG - Intronic
969430251 4:7149805-7149827 GCACCCCGGGTCCTCTGTGGTGG - Intergenic
969669262 4:8580747-8580769 GCAGCCCGGGGCCGCCCTGGAGG - Exonic
981748429 4:148072149-148072171 GCAGCCCAGAGCCTCGGAGGAGG - Exonic
985552495 5:540735-540757 GCAGCCGGGAGCCTTCTTGGAGG - Intergenic
985808240 5:2064088-2064110 GAAGCCCGGAACCTCTCCGGAGG + Intergenic
997526949 5:134559760-134559782 GCTCCCTGGAGCCCCTATGGCGG + Intronic
998339864 5:141408040-141408062 GCAGCCGGGAGGCTCTGTGTGGG - Intronic
998340950 5:141417697-141417719 GCAGCCGGGAGCCTCTGTGTGGG - Exonic
1001005563 5:168046889-168046911 GCAGCCAGCAGCATCTATAGTGG - Intronic
1001579355 5:172788344-172788366 GCAGCCCTGAGACTGTATGTTGG - Intergenic
1013803227 6:113970584-113970606 GCAGTCCGCAGCCTCGAAGGTGG - Intronic
1015312920 6:131784471-131784493 GCAGCCCAGACCCTCTATCTAGG - Intergenic
1024200766 7:47103723-47103745 GCAGCCCTGAGCCTCAGTCGTGG - Intergenic
1026913390 7:74105868-74105890 GCAGCCCGGATCCACTCTGTGGG - Exonic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1036669540 8:10772378-10772400 CCTGCCCTGAGCCACTATGGCGG + Intronic
1036760284 8:11503935-11503957 CCGGCCAGGAGCCTCTCTGGGGG - Intronic
1038326571 8:26577167-26577189 GCAGCCCGGCGCCTCCACGCGGG + Intronic
1054763991 9:69027349-69027371 GCACCCCGGGGCCACTTTGGTGG - Intergenic
1061076232 9:128343135-128343157 GCTGCTTGGAGCCTCTCTGGTGG + Exonic
1062710288 9:137971734-137971756 GCCTCCAGGAGCCTCTGTGGGGG + Intronic
1203474829 Un_GL000220v1:142126-142148 CCGGGCCGGAGCCGCTATGGGGG - Intergenic
1190115514 X:47623963-47623985 GCGGCCCTGAGGCTCTAAGGGGG + Intergenic
1200099851 X:153685012-153685034 CCAGCCCAGAGCTCCTATGGTGG - Intronic