ID: 966899392

View in Genome Browser
Species Human (GRCh38)
Location 3:184469440-184469462
Sequence TCTGACATGCAGAGGGTCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966899385_966899392 5 Left 966899385 3:184469412-184469434 CCTGAAGCTTAAGCTACATTATC 0: 1
1: 0
2: 9
3: 58
4: 226
Right 966899392 3:184469440-184469462 TCTGACATGCAGAGGGTCCGGGG 0: 1
1: 0
2: 1
3: 14
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966899392 Original CRISPR TCTGACATGCAGAGGGTCCG GGG Intronic
903283472 1:22263247-22263269 CCTGACATGCCGAGGGGCCGTGG + Intergenic
903848201 1:26290830-26290852 TCAGAGATGCAGAGGGTGGGGGG + Intronic
906775956 1:48529816-48529838 CTTGACATGCAGAGGGCCCCTGG - Intergenic
909223145 1:72987580-72987602 TCTGACATGCACACAGCCCGAGG + Intergenic
910588052 1:88900543-88900565 TCTGACTTACAGTGGGTCCCTGG + Intergenic
912253587 1:108036271-108036293 ACTGACATCCAGAAGGTCCTGGG - Intergenic
920291070 1:204923538-204923560 TCTGACAGGCAGAGGGACTTAGG - Intronic
920925544 1:210338044-210338066 ACTGACAGGCAGAGGATCTGGGG + Intronic
922331650 1:224582155-224582177 TTTGACATGCTGAGGGCCTGGGG + Intronic
922905494 1:229170624-229170646 CCTGAGAGGCACAGGGTCCGTGG + Intergenic
923538687 1:234872485-234872507 TCTGACATGCAGCAGGTACTGGG + Intergenic
1062890652 10:1057103-1057125 CTTGGAATGCAGAGGGTCCGTGG + Intronic
1066658780 10:37720096-37720118 TCTGAGATGCAGAGGGGGCTGGG - Intergenic
1067098366 10:43317072-43317094 TCTGGCCTGCAGAGGCTCCCAGG - Intergenic
1067386276 10:45819888-45819910 TCTGAGAGGCAGAGGGGCAGTGG + Intergenic
1067447992 10:46364677-46364699 TCTGAGAGGCAGAGGGGCAGTGG - Intergenic
1067589385 10:47496084-47496106 TCTGAGAGGCAGAGGGGCAGTGG + Intergenic
1067636512 10:48004163-48004185 TCTGAGAGGCAGAGGGGCAGTGG + Intergenic
1067876976 10:50016162-50016184 TCTGAGAGGCAGAGGGGCAGTGG - Intergenic
1068183162 10:53548483-53548505 TCTGACATGCAGAATGTCTCTGG + Intergenic
1070133061 10:73668147-73668169 TCTGAGAGGCAGAGGGGCAGTGG + Intergenic
1071601080 10:86959014-86959036 TCTGACACCCAGAGGCCCCGAGG - Intronic
1071608609 10:87015887-87015909 TCTGAGAGGCAGAGGGGCAGTGG - Intergenic
1076198983 10:128542900-128542922 TCTGACCTGCAGAGTGGCTGCGG - Intergenic
1081547123 11:44079431-44079453 TCAGAAATCCAGAGGGGCCGGGG - Intronic
1083208994 11:61170950-61170972 TCTGACCTCCAGCTGGTCCGAGG - Intergenic
1084954940 11:72686036-72686058 ACTCACAGACAGAGGGTCCGCGG + Exonic
1091061087 11:132462868-132462890 TCAGACATGGAGAGGGACAGGGG + Intronic
1102224442 12:111217944-111217966 TCTGACATGCTGTGGGCCCTGGG - Intronic
1104611557 12:130232854-130232876 TTTGACATGCTGAGGTCCCGTGG - Intergenic
1105408092 13:20148208-20148230 GATGACATGCAGAGGCTCTGGGG + Intronic
1106693185 13:32141856-32141878 GGTGAGATGCAGAGGGTCCAGGG + Intronic
1106958829 13:34973920-34973942 TCAGACATGCAGAGGGGCCCAGG - Intronic
1109943876 13:69406691-69406713 TCTGACTTGCAGTGGGTCCAGGG - Intergenic
1112205454 13:97319494-97319516 TTTGACATACAGAGGGACAGTGG - Intronic
1112231293 13:97591378-97591400 TCTGACTTACAGTGGGTCCACGG - Intergenic
1116898036 14:50336204-50336226 ACTGACAGGCAGAGGGACTGGGG + Intronic
1120484121 14:85088784-85088806 TCTGACATGCAGGGGCTGCGTGG + Intergenic
1121496137 14:94392331-94392353 TGTGACATGCAGAGGATGTGGGG + Intergenic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1126515084 15:49524847-49524869 TCAGACTTGCATGGGGTCCGTGG + Intronic
1128706321 15:69839770-69839792 TGTGCCAGGCACAGGGTCCGTGG + Intergenic
1132478273 16:153333-153355 TCTGACAAGCAGAGGGTGAAAGG + Intronic
1132480358 16:163923-163945 TCTGACAAGCAGAGGGTGAAAGG + Intronic
1134381996 16:13736216-13736238 TCTGACATTCAGATGGACCTAGG - Intergenic
1139357137 16:66373118-66373140 CCAGACATTCAGAGGGTCTGAGG - Intronic
1140938726 16:79700926-79700948 TTTGAGATTCAGAGGGTCCATGG + Intergenic
1141407028 16:83803776-83803798 CCTGACAAGCAGAGGGTCTCAGG - Intergenic
1141981821 16:87555269-87555291 ACTGAAAGGCAGAGAGTCCGTGG + Intergenic
1143131260 17:4678933-4678955 TCTGTCATGCAGAGGCTCCAGGG - Intronic
1144642066 17:16943104-16943126 TCTGTCATGCAGATGGTGCTGGG - Intronic
1147460089 17:40562816-40562838 GCTGACAAGCAGAGTGTCCTGGG - Intronic
1148077476 17:44947226-44947248 ACTGACATGCAGGGAGTCCCAGG + Intronic
1148694447 17:49550477-49550499 TCTCACTTTCAGAGGGCCCGAGG + Intergenic
1150224154 17:63513871-63513893 TCTGACATGCAGTGGCCACGAGG - Intronic
1150768362 17:68020406-68020428 CCTGCCCTGCAGAGGGTCCCGGG - Intergenic
1151654709 17:75490483-75490505 TCTGGAATGGAGAGGGCCCGAGG - Intronic
1156291572 18:35752612-35752634 TGTCACTTGCAGAGGGTCCCAGG + Intergenic
1157690958 18:49681363-49681385 CCAGAGATGCAGTGGGTCCGTGG - Intergenic
1160006194 18:75070719-75070741 TGTGACATGCGGGGGGTCAGGGG - Intergenic
1160135782 18:76270457-76270479 TCTGACATGCAGAGGGGCTTAGG - Intergenic
1160222767 18:76989258-76989280 TCTGACATTCAGAGCTTCCAAGG + Intronic
1161517529 19:4704586-4704608 TCTGCTATGGAGAGGGTCTGTGG - Intronic
1162647107 19:12057859-12057881 TGTGACCTGCAGAGGGTTTGGGG - Intergenic
1162654233 19:12116738-12116760 TCTGACATGCATAGGGTCCCTGG + Intronic
1162657367 19:12141032-12141054 TTTGACATGCATAGAGTCCCTGG - Intronic
1163666482 19:18606244-18606266 CCTGGCATGCAGAGGGTCTCAGG + Intronic
1164715334 19:30386688-30386710 TCTGACATGTAGTGGGTCTTTGG + Intronic
1167684931 19:50950214-50950236 TCTGACATGCTGAGGGGGCAGGG + Intronic
927637844 2:24828903-24828925 TGTGACATGCAGGGGGCCTGGGG + Intronic
928274776 2:29890637-29890659 TCAGAGATTCAGAGGGGCCGTGG - Intronic
929408890 2:41674288-41674310 TCTGACATCCAGATGCTCTGTGG - Intergenic
931936846 2:67207888-67207910 ACTGGCATGCAGATGGTCTGAGG - Intergenic
939894522 2:147775637-147775659 TGTGACAGGCAGAGGGCCAGTGG + Intergenic
940000569 2:148963039-148963061 GCTGACATGCAGTGGGTGGGTGG + Intronic
941555309 2:166972137-166972159 TCTCACATGCAGAGAGTGAGAGG - Intronic
941622018 2:167788948-167788970 TCTCCCAGGCAGAGGGTCAGTGG + Intergenic
946047149 2:216830676-216830698 TCTGCCTTGAAGAGGGTCAGGGG + Intergenic
948068663 2:235102202-235102224 GCTCACATGCACAGGCTCCGTGG + Intergenic
1168893937 20:1311024-1311046 TCTGACAGGCTCGGGGTCCGAGG - Intronic
1171300204 20:24053135-24053157 TCTGACCTGCAGGGGATCCCCGG + Intergenic
1172007167 20:31825410-31825432 TCTGCCATTCAGTGGGTCAGGGG + Intronic
1172885462 20:38228068-38228090 CCTGACATTCATAGAGTCCGGGG - Intronic
1173030854 20:39358320-39358342 TCTTACATGCAGAAGGGCCTGGG + Intergenic
1174631584 20:51962960-51962982 TTTGAAAGGCAGAGGGTCTGAGG + Intergenic
1177833845 21:26169761-26169783 TCTGAGAGGCAGAAGGTCCGCGG - Intronic
1178100873 21:29267296-29267318 GCAGAGATGCAGAGGGTCTGTGG - Intronic
1178135707 21:29625030-29625052 TCTGACATGTGGAGGGCACGAGG + Intronic
1180168019 21:46040133-46040155 AGGGACATGCAGAGGGTCCTGGG - Intergenic
1183308477 22:37096740-37096762 TCTGCCCTGCAGAGGGTCCCAGG - Intronic
1185059234 22:48597421-48597443 GCTCACATGCAGAGTGTCCTGGG + Intronic
950421549 3:12902564-12902586 GCTGACATGCACAGGGTTCCAGG + Intronic
955035431 3:55262875-55262897 TCTGACTTACAGTGGGTCCCTGG + Intergenic
955589713 3:60522012-60522034 TCTGACCTACACAGGGTCCCTGG - Intronic
959308347 3:104697249-104697271 TCTGACATACAGAGAGTCACAGG - Intergenic
961056543 3:123793705-123793727 TCTTTGATGCAGAGGTTCCGAGG + Exonic
963003012 3:140700812-140700834 TCTGACATGCAGAAGGGCCCAGG + Intronic
964155369 3:153578724-153578746 TGTGACATGCAGAGTGGCTGTGG + Intergenic
964719818 3:159760290-159760312 TCTGCCCTGCAGAGGCTCCTTGG - Intronic
964724017 3:159795576-159795598 CCTGACATGCAAAGAGTCCCTGG + Intronic
966899392 3:184469440-184469462 TCTGACATGCAGAGGGTCCGGGG + Intronic
969601613 4:8179735-8179757 CCTGACCTGCAGAGGGTCCATGG + Intergenic
970005529 4:11407369-11407391 TCAGACATGCAGAGGATTCAAGG - Intronic
970814368 4:20136892-20136914 TCGGACATGTAGAGGGTGGGAGG - Intergenic
972697420 4:41461483-41461505 TTTGAGAAGCTGAGGGTCCGTGG + Intronic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
977659187 4:99563382-99563404 TCTGAAATGTAGAGAGCCCGAGG - Exonic
978498807 4:109386920-109386942 TCTGATTTGCATAGGGTCCATGG + Intergenic
984154294 4:176175501-176175523 TAACAAATGCAGAGGGTCCGTGG + Intronic
984565676 4:181327366-181327388 TCAGATATTCAGAGGATCCGAGG - Intergenic
985553411 5:544452-544474 TCTCACACGCTGAGGGGCCGGGG + Intergenic
985652976 5:1115615-1115637 GCTGGCAGGCAGAGTGTCCGTGG + Intergenic
987657282 5:20822861-20822883 TCTGACTTACAGAGGGTCCCTGG - Intergenic
988766264 5:34381087-34381109 TCTGACTTACAGAGGGTCCCTGG + Intergenic
991509732 5:67363516-67363538 TCTTCCATGCAGAAGGTCTGGGG + Intergenic
991514055 5:67414516-67414538 TGTGACATGCAGAGACTCTGGGG + Intergenic
994395563 5:99223519-99223541 TCTAATATCCAGAGGGTCAGAGG - Intergenic
1001870644 5:175151329-175151351 TCTGACATGCAGCTGGTCAATGG + Intergenic
1007114761 6:39335687-39335709 TCTGTCATGGAGAGGGCCCATGG + Exonic
1012906062 6:105067459-105067481 TCTCACATGCAGTGGGTACTCGG - Intronic
1022279325 7:28890234-28890256 TCTGATTTGCATAGGGTCCAGGG + Intergenic
1023279152 7:38552255-38552277 TCTGAAGTGCAGGGGGTCCTGGG - Intronic
1024374749 7:48624216-48624238 TATGACATGCAGAGGATTTGAGG - Intronic
1025795290 7:64733927-64733949 TCTGCCATGGAGAGGATCCATGG - Intergenic
1027363636 7:77434404-77434426 TTTGAAATGCAGATGGGCCGAGG - Intergenic
1035108752 7:156463205-156463227 TCTGACAGGCAGAGCTTCTGAGG - Intergenic
1035459879 7:159032105-159032127 CCAGGCTTGCAGAGGGTCCGAGG - Intronic
1036706769 8:11052483-11052505 TCTGGCATGCAGATGGCGCGAGG + Intronic
1039878757 8:41610127-41610149 TCTGATATGCAGAGAATCCAAGG - Intronic
1040401719 8:47057151-47057173 TCTGATTTGCATAGGGTCCAGGG + Intergenic
1040683971 8:49848140-49848162 TCTGGGATGCAGAGGCTCCTGGG + Intergenic
1041748385 8:61233731-61233753 TGTGACAGGCACAGTGTCCGTGG + Intronic
1049220527 8:141426834-141426856 TCTGAGAGGCAGAGGGTGCCAGG - Intronic
1051450561 9:17193199-17193221 CATGACATGCGGAGGGGCCGGGG - Intronic
1056896855 9:90559253-90559275 GCTGACATGCACAGGGTTGGCGG - Intergenic
1060518871 9:124282679-124282701 TCTGGGATGCAGAGAGTCAGGGG - Intronic
1060964715 9:127706132-127706154 TCTGACCTCCAGTGGGTCCTTGG - Intronic
1061884244 9:133583642-133583664 TCTGAGATGCAGCCGGTCCCTGG + Intronic
1186686426 X:11929642-11929664 CCTCACATGGAGAGTGTCCGGGG - Intergenic
1187269182 X:17764615-17764637 TCTGACATTCAGAGGGTTCTTGG - Intergenic
1187320335 X:18232048-18232070 TCTGACATTCAGAGGGTTCTTGG + Intergenic
1191204860 X:57822866-57822888 TCTGATTTGCATAGGGTCCAGGG + Intergenic
1196009501 X:110871944-110871966 TCTGACAGGTAGAGGATCCCAGG + Intergenic
1197097310 X:122611615-122611637 TCTGACTTACAGTGGGTCCTTGG + Intergenic
1200077949 X:153561032-153561054 TCCGACATGCAGAGAGGACGGGG - Intronic