ID: 966903717

View in Genome Browser
Species Human (GRCh38)
Location 3:184506798-184506820
Sequence GCATTGGACTTCCCCTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966903717_966903722 10 Left 966903717 3:184506798-184506820 CCTTCTGAGGGGAAGTCCAATGC 0: 1
1: 0
2: 0
3: 9
4: 113
Right 966903722 3:184506831-184506853 GTTCCCCCTCCCGTCTGGCTTGG 0: 1
1: 0
2: 1
3: 4
4: 122
966903717_966903721 5 Left 966903717 3:184506798-184506820 CCTTCTGAGGGGAAGTCCAATGC 0: 1
1: 0
2: 0
3: 9
4: 113
Right 966903721 3:184506826-184506848 CCAATGTTCCCCCTCCCGTCTGG 0: 1
1: 0
2: 1
3: 4
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966903717 Original CRISPR GCATTGGACTTCCCCTCAGA AGG (reversed) Intronic