ID: 966903982

View in Genome Browser
Species Human (GRCh38)
Location 3:184508553-184508575
Sequence GGTTAGACACAATTCCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966903973_966903982 28 Left 966903973 3:184508502-184508524 CCGCTTTCTCTGTCTCTTCCACA 0: 1
1: 0
2: 16
3: 223
4: 1786
Right 966903982 3:184508553-184508575 GGTTAGACACAATTCCAGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 93
966903976_966903982 1 Left 966903976 3:184508529-184508551 CCTGCTGCTGATACCTCTACCCT 0: 1
1: 0
2: 1
3: 12
4: 165
Right 966903982 3:184508553-184508575 GGTTAGACACAATTCCAGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 93
966903975_966903982 10 Left 966903975 3:184508520-184508542 CCACAGGTACCTGCTGCTGATAC 0: 1
1: 0
2: 0
3: 18
4: 169
Right 966903982 3:184508553-184508575 GGTTAGACACAATTCCAGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966903982 Original CRISPR GGTTAGACACAATTCCAGCA GGG Intronic
910654259 1:89604084-89604106 AGTTAGAAACATTCCCAGCAGGG + Intergenic
912258730 1:108087359-108087381 GGACAGACAGAATTGCAGCAGGG + Intergenic
916349451 1:163832512-163832534 GGTTGGTCACATTTCCAGCATGG - Intergenic
919482982 1:198112029-198112051 CGTATGACACAATTCCATCAGGG - Intergenic
922071762 1:222201800-222201822 GTTTAGACACAATTGAAGAAAGG + Intergenic
1063477901 10:6344598-6344620 CCTTGGCCACAATTCCAGCAAGG - Intergenic
1064651754 10:17516661-17516683 GGTTACAAACAAGTCCAGGACGG + Intergenic
1065436395 10:25707557-25707579 TGTTAGACACAAAACCAGCTGGG - Intergenic
1069063624 10:63919884-63919906 GATTAGGCACAATTCCTGCATGG - Intergenic
1069336515 10:67358057-67358079 GGTTAGTCATTCTTCCAGCATGG - Intronic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1075908359 10:126102456-126102478 AGTTAGGCACCATTCCAACATGG + Intronic
1076439392 10:130470319-130470341 GGTGAGACACATTTCCAGAGGGG - Intergenic
1082029122 11:47592176-47592198 GGACAGCAACAATTCCAGCAGGG + Intronic
1083078826 11:60069602-60069624 GGTTACGCATAATTCCAGCAAGG - Exonic
1083355668 11:62064260-62064282 GGTTAGACATGATTGAAGCATGG + Intergenic
1089156317 11:116405619-116405641 GTTAAGACACAACTCCAGAAGGG + Intergenic
1093137662 12:15471642-15471664 GGTCAGACACAATTCTAGGAAGG + Intronic
1102307538 12:111816792-111816814 GACTAGACCAAATTCCAGCAAGG - Intergenic
1106033145 13:26020568-26020590 TCTTAGCCACATTTCCAGCAGGG + Exonic
1114285526 14:21239209-21239231 GTTTAGTCACATTTCCAGCCAGG + Intronic
1115001053 14:28420251-28420273 GACTGGACCCAATTCCAGCAAGG + Intergenic
1116752640 14:48905888-48905910 GTTTAGACACATATCCACCATGG - Intergenic
1125443510 15:39728809-39728831 GGGTAAACACAATTACAGAATGG + Intronic
1126974463 15:54159142-54159164 AGTAAGACACATTGCCAGCAGGG - Intronic
1127432756 15:58926983-58927005 GGTTGGACAGTATTCCAGCAAGG + Intronic
1130061563 15:80574243-80574265 GGCTGGAGACAATTCCAACAGGG - Intronic
1130554799 15:84915152-84915174 GGCTAGAAACACCTCCAGCACGG - Intronic
1131843573 15:96465040-96465062 GCTTAAACACAATTCAAGCAAGG + Intergenic
1135886914 16:26318485-26318507 CCTTGGACACATTTCCAGCATGG + Intergenic
1139835615 16:69836223-69836245 GTTTAGTCACAATTCACGCATGG + Intronic
1140845322 16:78881534-78881556 GGTTAGAGACTATTCCAGCAAGG - Intronic
1145403505 17:22566778-22566800 GGTTAGGCAAAATTACAGGATGG - Intergenic
1146987985 17:37240475-37240497 GTAGAGACACAATTCCAGAATGG - Exonic
1150907269 17:69351127-69351149 GGATAGATACATTTCCAGGAAGG - Intergenic
1151461630 17:74257629-74257651 GGGAAGAAACATTTCCAGCAAGG - Intronic
1157004159 18:43561262-43561284 GGTTGGACTCTATTCTAGCATGG + Intergenic
1158551329 18:58438599-58438621 GTTAAGACACAATTCCAGTCTGG - Intergenic
1161354175 19:3810101-3810123 GGCAAGACACCACTCCAGCACGG + Intronic
1164509173 19:28883454-28883476 GATCAGACACACTCCCAGCAAGG - Intergenic
1167945488 19:52985144-52985166 ACTTGGACAGAATTCCAGCAGGG - Intergenic
1168576712 19:57517855-57517877 GCTTGGGCAGAATTCCAGCAAGG + Intronic
1168680795 19:58314303-58314325 GCTTAAACAGAATTCCAGCAGGG + Intronic
925953613 2:8939135-8939157 TGGTAGACAGAATTCCAGTAAGG - Intronic
926470600 2:13251920-13251942 TGTAAGACAGAATCCCAGCAAGG + Intergenic
933786331 2:85845606-85845628 GGATTGACACAACTGCAGCAGGG + Intronic
935397429 2:102622600-102622622 GGTGAGCCAGAATTCCAGCCAGG + Intronic
937858200 2:126687794-126687816 GACTACACACACTTCCAGCAGGG - Intronic
939616313 2:144365260-144365282 GGAGAGACACGATTCCAGCAGGG - Intergenic
940503045 2:154518727-154518749 GGTTTGAGACAAATGCAGCATGG + Intergenic
941775522 2:169389088-169389110 GGTTAGTCAGCACTCCAGCAAGG - Intergenic
943458182 2:188134673-188134695 TGTTAGACACTATTTCAGGAAGG + Intergenic
948612960 2:239181199-239181221 GGTGGGACTCAATTCCAGCCAGG + Intronic
1170442222 20:16390627-16390649 GGTGAGATAGAATTCCAGCCTGG - Intronic
1171566611 20:26198345-26198367 TGTAAGACACAATGTCAGCAAGG - Intergenic
1177440923 21:21122917-21122939 TGTGAGAAACAAATCCAGCAAGG + Intronic
1179344911 21:40547173-40547195 GTGTAGACACAATAGCAGCAAGG + Intronic
1180035826 21:45248682-45248704 GGTCAGATTCAATTCCAGAAAGG - Intergenic
1181838675 22:25634292-25634314 GTTTAGAGACAATTCTAGTATGG + Intronic
1184986751 22:48141080-48141102 TGGTAGACACATGTCCAGCATGG - Intergenic
952306159 3:32148316-32148338 GTTCAGACACAAGACCAGCATGG - Intronic
953237309 3:41117990-41118012 GGGTAAACACAATTAGAGCATGG + Intergenic
957111532 3:75966210-75966232 TGTAAGACACAATGTCAGCAAGG + Intronic
957192975 3:77034331-77034353 TGTTAGATACAATGCCAGCCAGG - Intronic
962247674 3:133810244-133810266 GATTTAACACAATTCCAGCTGGG - Intronic
962476923 3:135763089-135763111 GGTTAGGCACAATTTCAGGAGGG + Intergenic
962645681 3:137436794-137436816 GGTAAAACAGAATTCCAGGAAGG + Intergenic
966779498 3:183571681-183571703 GGTCACACAAAAATCCAGCATGG + Intergenic
966903982 3:184508553-184508575 GGTTAGACACAATTCCAGCAGGG + Intronic
968087164 3:195878959-195878981 GGTGAGAGGCAGTTCCAGCAGGG + Intronic
972485858 4:39539877-39539899 GCTTGGGCAGAATTCCAGCAAGG - Intergenic
977975295 4:103256790-103256812 GGTTTTCCACAATTTCAGCATGG + Intergenic
978102585 4:104860714-104860736 AGTTCTACACATTTCCAGCAGGG - Intergenic
979502670 4:121457938-121457960 GGTCACACACAGTTCCAGTAAGG - Intergenic
982480433 4:155902568-155902590 AATTAGACAAAATTCCATCATGG + Intronic
986682293 5:10245123-10245145 GTTTAAACACAATTCAAGCTGGG + Intronic
989966945 5:50475663-50475685 TGCAAGACAAAATTCCAGCAGGG - Intergenic
993262328 5:85674500-85674522 GGTCAGTCACAATTCCCTCAGGG + Intergenic
995401494 5:111747411-111747433 AGTTTGATACATTTCCAGCAGGG - Intronic
997231315 5:132245484-132245506 GGTTAGAAAGAACTACAGCAGGG + Intronic
1000734290 5:164879773-164879795 TGTTAGTCCCAATTCCTGCAAGG + Intergenic
1001227154 5:169954831-169954853 GGTTACACACACTTGCAGCCTGG - Intronic
1002003550 5:176213606-176213628 GGATATACGTAATTCCAGCAAGG + Intergenic
1002222908 5:177697310-177697332 GGATATACGTAATTCCAGCAAGG - Intergenic
1004947735 6:20634680-20634702 GATTAAACATGATTCCAGCAAGG + Intronic
1009897912 6:69775719-69775741 TGTGAGACACAAGTACAGCATGG - Intronic
1012107052 6:95175725-95175747 GGATATACACTATTCCTGCAAGG - Intergenic
1014754681 6:125289791-125289813 GGTTAGAAACAATCCAAGGACGG + Intronic
1018989644 6:168663995-168664017 GGTTCAACACAATTTCAGGAAGG - Intronic
1027790141 7:82629914-82629936 GGTTAGAAAAAATTCCAAGATGG + Intergenic
1035106764 7:156447484-156447506 GGGTAGACACATTTCCAGTTTGG - Intergenic
1039180683 8:34862555-34862577 GAATAGAAACAATTCCAGAATGG + Intergenic
1041476900 8:58277363-58277385 AGTTTCACACAATACCAGCAAGG - Intergenic
1047023973 8:120807570-120807592 GGTTAAACACATGGCCAGCAAGG - Intronic
1048884571 8:138899406-138899428 GGTGAGACACAATACCCTCAAGG + Intronic
1049464804 8:142746130-142746152 TGTCAGACACAACTCAAGCAGGG + Intergenic
1055037085 9:71829263-71829285 GATTAGACTCAACTCCAACAAGG + Intergenic
1059162282 9:112046509-112046531 GGTTAAAGATAAGTCCAGCAAGG - Intronic
1186209882 X:7239207-7239229 GTTTAGACACAATTTCAGAATGG + Intronic
1189048512 X:37618846-37618868 GGAGAGACACAATTCAACCAGGG + Intronic
1189853677 X:45201188-45201210 GGTTGGACACACATCCTGCATGG - Intergenic
1190407656 X:50103682-50103704 GATTAGAAACAATTCTAGGAAGG + Intergenic
1193697716 X:84729586-84729608 GGTTAGACACCATTGCTGGAGGG + Intergenic
1196839053 X:119841106-119841128 AGATAGACAGAATTCCAGAAAGG - Exonic
1196903127 X:120406281-120406303 TGTTAGACAGAATACCAGAAAGG - Intergenic