ID: 966905555

View in Genome Browser
Species Human (GRCh38)
Location 3:184522403-184522425
Sequence CAGCGGAAGCCTGCTGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 190}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966905555 Original CRISPR CAGCGGAAGCCTGCTGGTGG GGG Intronic
900766801 1:4511410-4511432 CAGCCGATGCCTGCTGGGGGTGG + Intergenic
901024481 1:6271861-6271883 CAACGGGAGGCTGCTGGCGGAGG + Intronic
904301309 1:29556601-29556623 CAGAGGAAGCCTCATGGAGGAGG + Intergenic
904339928 1:29828137-29828159 CAGAGGAGGCCTCCTGGAGGAGG + Intergenic
909475834 1:76079872-76079894 CAGAGGAAGCCTGCTGAGGCAGG - Intronic
913319926 1:117581058-117581080 CAGGGAAAGCCTCCTGGAGGAGG + Intergenic
915728729 1:158037685-158037707 CAGAGGATGCTTGCTGGAGGAGG - Intronic
915902983 1:159859795-159859817 CACTGGAAGCCAGCTTGTGGGGG - Intronic
917072848 1:171171084-171171106 CAGTGGAAGCTTGGTGGTGATGG - Intergenic
917091284 1:171355936-171355958 GAGAGGAAGCCTGCAGGAGGGGG - Intergenic
920196793 1:204233285-204233307 CAGCCTAAGCCTCCTGGAGGAGG + Intronic
921609639 1:217195748-217195770 CAGCAGAACCCTGGAGGTGGAGG + Intergenic
924471314 1:244344988-244345010 CATCTGAAGCCTGCTGGGGAGGG - Intergenic
1063429802 10:5978108-5978130 CCGCGGGAGCCAGCAGGTGGCGG - Intronic
1066527492 10:36297019-36297041 CAGCTGAAGCCTGCCCATGGAGG - Intergenic
1069655317 10:70083439-70083461 CAGGGGAAGCCTACTGATGGTGG - Intronic
1071439707 10:85679497-85679519 CTGGGGAGGCCTGCTGGAGGAGG + Intronic
1071507760 10:86242958-86242980 CAGCGTAGGCCTGCTGGAGGTGG - Intronic
1074314630 10:112350018-112350040 GCGCGGAAGCCCACTGGTGGCGG - Intergenic
1074844670 10:117387005-117387027 CAGGGAAAGCTTCCTGGTGGAGG - Intergenic
1077056699 11:597449-597471 AGGCCGAAGCCTGCTGGTGGTGG - Exonic
1077224951 11:1435635-1435657 CTGCAGAAGGCTGCAGGTGGGGG + Intronic
1077376586 11:2208060-2208082 ATGCGGCTGCCTGCTGGTGGAGG + Intergenic
1083984965 11:66208050-66208072 CAGCAGAAGCCTGGGTGTGGTGG - Intronic
1084411902 11:69010387-69010409 CAGGGGGAACCTGCTGGAGGAGG + Intronic
1087630439 11:100644520-100644542 CAGAGGAGGCCTCCTGGAGGAGG + Intergenic
1088351259 11:108890928-108890950 GAGCAGAAGCCTGCTGGGAGGGG - Intronic
1090044053 11:123315476-123315498 CAGGGGAAGCCTCTTGGAGGAGG - Intergenic
1090381012 11:126327924-126327946 AAGAGGAAGCAAGCTGGTGGAGG + Intronic
1090747674 11:129720335-129720357 CAGGGGATGCCTGCAGGAGGAGG - Intergenic
1090968676 11:131620721-131620743 CAGTGCAGGCCTGCAGGTGGTGG - Intronic
1092123931 12:6062953-6062975 CCGCGGGAGGCTGCTGGTGAAGG - Exonic
1092373210 12:7934323-7934345 CCACGGAAGCCCACTGGTGGTGG + Intronic
1093721772 12:22451545-22451567 CAGAGGAAGACGACTGGTGGTGG + Intronic
1095964620 12:47858546-47858568 AGGCAGAAGCCTGCAGGTGGTGG - Intronic
1096908714 12:54961183-54961205 CAGCAAAAGTCTGGTGGTGGTGG + Exonic
1097374088 12:58819587-58819609 CTGCGGCAGCCTCCAGGTGGGGG - Intergenic
1100189065 12:92171219-92171241 CAGGGGAAGGCTGCGGGTGACGG - Intergenic
1100695739 12:97090860-97090882 CATCAGAAACCTGCGGGTGGAGG - Intergenic
1102020518 12:109679017-109679039 CTGCATAAGCCTCCTGGTGGGGG + Intergenic
1102964994 12:117118972-117118994 CAGCTAAAGCCTGCTCGTTGGGG + Intergenic
1104053030 12:125209131-125209153 AAGCGGGAGCCAGCAGGTGGTGG + Intronic
1104121526 12:125804652-125804674 CTGAGGCAGCCTGCTAGTGGTGG + Intergenic
1113395122 13:109940358-109940380 CAGGGAAAGCTTCCTGGTGGAGG + Intergenic
1118779017 14:68993761-68993783 GAAGGGAAGCCAGCTGGTGGAGG + Intergenic
1119757404 14:77128798-77128820 CACAGTGAGCCTGCTGGTGGGGG - Intronic
1123827731 15:24100922-24100944 CAGGGGAAGCCTCCAGGAGGAGG + Intergenic
1123842187 15:24260334-24260356 CAGGGGAAGCCTCCAGGAGGAGG + Intergenic
1123857210 15:24426394-24426416 CAGGGGAAGCCTCCAGGAGGAGG + Intergenic
1123861842 15:24476922-24476944 CAGGGGAAGCCTCCAGGAGGAGG + Intergenic
1125016232 15:34938447-34938469 CACTGGAACCCTGCTGGGGGAGG + Intronic
1128841217 15:70853370-70853392 CAGCGGACACTTGCTGATGGGGG - Intronic
1128994879 15:72288886-72288908 CAGCGTAGGCCTGCTGCAGGGGG + Exonic
1129621065 15:77146202-77146224 CTGCTGATGCCTGCTGGAGGGGG - Intronic
1131458510 15:92602098-92602120 CAGGGGAAGAATGCTGGTGGAGG - Intergenic
1133342248 16:5044349-5044371 CAGCGGCTGCTTGGTGGTGGCGG + Exonic
1133619714 16:7514587-7514609 CAAGGAAAGCCTGCTGGAGGAGG + Intronic
1134236735 16:12472231-12472253 CAGGGGAAGGCTGGGGGTGGTGG + Intronic
1135167811 16:20156229-20156251 CCGCAGAAGCCTGCTGGAGCAGG - Intergenic
1136420706 16:30130956-30130978 CAACGGAAGCCAGCAGGTGGTGG - Intergenic
1136456254 16:30381461-30381483 CACCGGAAGCCAGCTGGGTGTGG + Exonic
1138535596 16:57658628-57658650 CGGCGGAAGGCTGGGGGTGGAGG + Intronic
1138553198 16:57758346-57758368 CAGAGGCAGCCAGCGGGTGGGGG - Exonic
1143425235 17:6831163-6831185 CAGGGGAAGCCAGCTGGCAGAGG + Intronic
1143453367 17:7050301-7050323 CAGCGGGAGCCCCTTGGTGGGGG - Intergenic
1143524787 17:7465921-7465943 CCTCGGAAGCCCACTGGTGGAGG + Exonic
1144484173 17:15651395-15651417 CAGGGGGATCCTGCTGGTGAGGG - Exonic
1145900478 17:28487705-28487727 CAGCAGAATCCTGCTGGGGGAGG + Intronic
1145950363 17:28812420-28812442 AAGCGGCAGCCGGCTGGGGGAGG - Intronic
1146131665 17:30282298-30282320 CACCGGAACCCTGCAGGTGGTGG - Intronic
1147573786 17:41587276-41587298 TAGAGGAAGCCTGCTGCTGCAGG + Intergenic
1147915198 17:43881627-43881649 CAGCAGAAGGCTGCAGGTGGAGG + Intronic
1148865857 17:50628249-50628271 CAGAGGCAACCTCCTGGTGGAGG + Intergenic
1150469331 17:65423481-65423503 CAGCGGAAGATTGCAGCTGGAGG + Intergenic
1151684150 17:75636972-75636994 CAGCCGCAGCCTGCTGCTGCTGG + Exonic
1151947670 17:77328247-77328269 CAGCTGACACCTGTTGGTGGAGG - Intronic
1152865310 17:82719007-82719029 CGGCGGGAGCGTGCTGGTGATGG + Exonic
1152888202 17:82864909-82864931 CAGCGGGGGCCTGCTTGTGTTGG + Intronic
1153268708 18:3297175-3297197 AAGCGGAACCCTGCGGGTGAGGG + Intergenic
1155812793 18:30259488-30259510 CAGCAGAAGACTGCTGGTTCAGG - Intergenic
1156149216 18:34223368-34223390 CAGCGGGAGCCTGCTTTGGGTGG + Exonic
1157588226 18:48818736-48818758 CTGCAGAGGCCTGCCGGTGGTGG - Intronic
1159762754 18:72449063-72449085 AAGCAGAAGCCTGTTGGAGGAGG - Intergenic
1160248418 18:77179786-77179808 AAGGGGAGGCCTGCTGGGGGTGG + Intergenic
1160447309 18:78937571-78937593 CAGCAGAAGCCGGGTGGTGACGG - Intergenic
1162144528 19:8605599-8605621 TAGGGGAAGTCTGGTGGTGGCGG - Intronic
1163230273 19:15997256-15997278 CAGCTGAAGCCTTGGGGTGGAGG - Intergenic
1164258432 19:23549323-23549345 CAGCAGCAGCCTGGTGGTGGGGG + Intronic
1165983956 19:39751285-39751307 CAGCTGATGCCTGCTCATGGAGG + Intergenic
1166053003 19:40271894-40271916 CAGCGGTTGTCAGCTGGTGGTGG - Intronic
1166212924 19:41318801-41318823 CTGGGAAAGCCTCCTGGTGGTGG - Intronic
1167623458 19:50571180-50571202 CAGGGGAGGCCTCCTGGAGGAGG + Intergenic
929080956 2:38121713-38121735 CAGCAGATGGCTGCTGGAGGAGG + Intergenic
929316466 2:40484865-40484887 CAGCAGAAGGATGCTGGAGGTGG + Intronic
932603148 2:73144040-73144062 CAGAGGGAGTCTGGTGGTGGGGG - Intronic
932751645 2:74375106-74375128 GAGCTGAAGCCTGTTGCTGGAGG - Intronic
932865134 2:75333841-75333863 CAGAGGAAGCCATCTGGTGAAGG + Intergenic
933628890 2:84634012-84634034 CAGCAGAATCCTAATGGTGGAGG - Intronic
934521867 2:95025049-95025071 CAGCAGAAGGCTGCTGGTGGTGG - Intergenic
936713600 2:115161391-115161413 TAGCGGAAGCCTGCGGGGGGCGG + Intronic
936936870 2:117847423-117847445 CAGGGGAAGCTTCCTGGAGGAGG - Intergenic
938736540 2:134191462-134191484 CATCTGGAACCTGCTGGTGGGGG - Intronic
941172543 2:162156960-162156982 CTGAGGAAGCCTGCTGGGGTTGG + Intergenic
943501290 2:188693012-188693034 CAGAGGTAGGGTGCTGGTGGGGG + Intergenic
945968961 2:216217838-216217860 CAGCCCAAGGCTACTGGTGGTGG - Intergenic
948154609 2:235771277-235771299 CAGCAGAAGCCCTCTGGAGGCGG - Intronic
948252196 2:236538423-236538445 CAGCGGAAGCCAGGTGCTGTGGG + Intergenic
948887586 2:240891892-240891914 GAGCTGCAGCCTGCAGGTGGGGG - Intronic
1169475755 20:5929860-5929882 GAGGGGAAGGCTGCTGGAGGAGG + Intergenic
1171285967 20:23938254-23938276 CATGGGAGGGCTGCTGGTGGGGG + Intergenic
1172653980 20:36525765-36525787 CAGAGGAACCCTGCTTGTTGGGG + Intronic
1173370020 20:42426876-42426898 CAGGGGAAGCCAGCAGGTGATGG + Intronic
1173645752 20:44632161-44632183 CAGCAGAAGCCTTGGGGTGGGGG + Intronic
1174086637 20:48013403-48013425 CAGGGGAAGTTTGCTGGAGGAGG + Intergenic
1174582115 20:51579436-51579458 CAGAGGAAGCCGGCAGCTGGCGG + Intergenic
1175516140 20:59571583-59571605 CAGCGGAGGCATGCAGGTGCTGG - Intergenic
1175859365 20:62142240-62142262 CAGCGGCGGCCAGCTGGCGGGGG + Intronic
1179794131 21:43772695-43772717 CAGCGGAAGGCAGGTGGGGGAGG - Exonic
1179909807 21:44441775-44441797 CAGCGGCTGCCTTCTGGAGGAGG - Exonic
1180212242 21:46301945-46301967 CTGAGGAAGCCTGGGGGTGGAGG + Exonic
1181058916 22:20272739-20272761 CTGGGGAGGCCGGCTGGTGGGGG + Intronic
1181273450 22:21674083-21674105 CAGCGGGAGCCTCCTGGGGCTGG - Intronic
1182709246 22:32310399-32310421 CAGAGGAAGCCTTGGGGTGGGGG - Intergenic
1183334957 22:37241250-37241272 CTGCGGAAGCAGGCTGCTGGAGG - Intronic
1183641752 22:39097079-39097101 CAGGGGAAGTCTGATGGAGGTGG - Intergenic
1183664829 22:39241310-39241332 CAGGGCAGGCCTGCTGGTGGAGG - Intronic
1184129584 22:42509819-42509841 GACCGGAAGCCTGTTGGGGGTGG + Intergenic
1184139788 22:42571917-42571939 GACCGGAAGCCTGTTGGGGGCGG + Intronic
1184396842 22:44247334-44247356 CAGAGGAAGCCTTGAGGTGGGGG - Exonic
1184425983 22:44409598-44409620 CAGAGGAAGGCTGGTGCTGGGGG - Intergenic
949604692 3:5640013-5640035 CAGCTGAAGCCTTCAAGTGGTGG - Intergenic
959584065 3:108009423-108009445 CTGCTGAAGCCAGCTGGTGATGG - Intergenic
960129956 3:114045294-114045316 CAGTGGGAGGCTGTTGGTGGTGG - Intronic
961551682 3:127673251-127673273 CAGCGGAAGCGCGCTGGGGCGGG + Intronic
961794299 3:129398586-129398608 CAGAGGAAGCCTCCAGGTAGCGG - Intergenic
962493365 3:135915486-135915508 AAGGGGAAGTCTGCTGGGGGTGG + Intergenic
962688279 3:137868348-137868370 CAGCTGATGCCTGCTCATGGAGG + Intergenic
963437406 3:145289061-145289083 CAGCTGAGGCCTGGTGTTGGGGG + Intergenic
966553297 3:181229874-181229896 CAGCGGCAGCCTGCCTGTTGGGG + Intergenic
966905555 3:184522403-184522425 CAGCGGAAGCCTGCTGGTGGGGG + Intronic
967279257 3:187806303-187806325 CAGGGGAAGCCAGCTGATGTGGG + Intergenic
973167128 4:47091851-47091873 CAGCGGGAGGTAGCTGGTGGAGG - Intronic
975335347 4:73169846-73169868 CAGCTGATGCCTGCTCGTGGAGG + Intronic
979113961 4:116797048-116797070 AAGCAGGAGCCTGGTGGTGGGGG - Intergenic
980865958 4:138553430-138553452 CCGCGGGAGCCCACTGGTGGGGG - Intergenic
980944001 4:139301645-139301667 CACCCGAGGCCTGGTGGTGGCGG + Exonic
983860353 4:172698401-172698423 CAGCGGAAGGAAGCTGGTCGTGG - Intronic
985570747 5:643544-643566 CAGCAGAAGCCTCGTGCTGGGGG - Intronic
986962493 5:13232258-13232280 AATTGGAAGCCTGCTGTTGGTGG + Intergenic
990609690 5:57444789-57444811 CAGCTGGAGGCTGCTGGTGGTGG - Intergenic
991050899 5:62272017-62272039 CATGGGAAGCGTGCTGATGGTGG - Intergenic
991471140 5:66970214-66970236 CAAGGGAAGCCTCCAGGTGGTGG - Intronic
991553548 5:67870048-67870070 CAGGGGATGCCTGCTGATTGAGG - Intergenic
994238502 5:97393053-97393075 CAGGGGTAGCTTCCTGGTGGTGG - Intergenic
994625633 5:102215171-102215193 CAGCGGACCCCTGCTGGGGGTGG - Intergenic
996210022 5:120797750-120797772 CAGGGTAAGGCTGCTGCTGGGGG - Intergenic
998157854 5:139796363-139796385 CAGTGGCAGCCTGGTGGTCGGGG + Intronic
1002087385 5:176784732-176784754 GAGAGGAAGGCTGCTGCTGGGGG + Intergenic
1005113686 6:22313661-22313683 AGGCAGAAGCCTGCTGGAGGGGG - Intergenic
1006387957 6:33742458-33742480 CAGGGGCAGCATGCTGCTGGTGG + Intronic
1006527273 6:34617654-34617676 CAGCGGTACTCTGCTGCTGGTGG - Intronic
1006637179 6:35469076-35469098 CAGCGGGAGCCTGCAGGGGAGGG - Intronic
1007689489 6:43690281-43690303 CACCTGAACCCTGCAGGTGGAGG + Intergenic
1008932507 6:56955052-56955074 CCGCGGCAGCCTGCGGGGGGCGG + Intergenic
1012946811 6:105475057-105475079 CAGTGGAAGCCAGATGATGGCGG - Intergenic
1013298738 6:108782932-108782954 CAGCAGATGCCTGTGGGTGGGGG + Intergenic
1017706961 6:157132411-157132433 CAGCGCAAGCCTGCAGTTGTTGG + Intronic
1019557675 7:1640841-1640863 CAGCCTGGGCCTGCTGGTGGTGG - Intergenic
1019690836 7:2410720-2410742 CAGCAGGAGCCTGCTGGGTGCGG + Intronic
1020137256 7:5594222-5594244 CCGCGAAAGGCTGCCGGTGGGGG - Intronic
1022088928 7:27095462-27095484 CAGCATAACCCTGGTGGTGGTGG + Exonic
1024701247 7:51906512-51906534 CACAGAAAGCGTGCTGGTGGGGG + Intergenic
1031561745 7:123247401-123247423 CAGAGAAAGGCTGCTGATGGAGG - Intergenic
1031992307 7:128206408-128206430 CATGGGAACCATGCTGGTGGGGG + Intergenic
1034120721 7:148625068-148625090 TGGTGAAAGCCTGCTGGTGGAGG - Intergenic
1034967289 7:155399164-155399186 CAGGGGTAGCCTGCAGGGGGCGG - Intergenic
1035054888 7:156028784-156028806 CAGCTGCTTCCTGCTGGTGGAGG + Intergenic
1035751698 8:2001393-2001415 CAGCGGTGGCCCGCGGGTGGTGG + Exonic
1036674139 8:10815687-10815709 CATCTGTAGCCTGCTGGTGTTGG - Intronic
1036751609 8:11447039-11447061 CAGTGGGAGCCTGCTGGTGGGGG - Intronic
1039006163 8:33039364-33039386 AAAAGGCAGCCTGCTGGTGGTGG - Intergenic
1039662344 8:39481140-39481162 CAGCTAAAGCCTCATGGTGGAGG - Intergenic
1041376069 8:57210236-57210258 CCCCGGAAGCCTGCTAATGGAGG - Intergenic
1042002228 8:64137586-64137608 CACCTGAAGCCGGCAGGTGGAGG - Intergenic
1042532675 8:69832127-69832149 CATCGGGAACCTGGTGGTGGTGG - Exonic
1045055705 8:98366718-98366740 CAGCTGAAGCCAGGTGGGGGTGG - Intergenic
1046895141 8:119463840-119463862 CAAAGGCAGGCTGCTGGTGGGGG - Intergenic
1049003044 8:139838226-139838248 CAGGGGAAGCCTCCTGGAGGAGG - Intronic
1049183206 8:141234190-141234212 CAGCCCTAGCCTGCTGGTGCTGG + Intronic
1049490204 8:142894401-142894423 CAGCTGATGCCTGCTCATGGAGG - Intronic
1050581414 9:7061472-7061494 GAGCAGAAGCCTGGTGCTGGTGG + Intronic
1053530846 9:38879378-38879400 CAGGGGCAGGGTGCTGGTGGAGG - Intergenic
1054203069 9:62103811-62103833 CAGGGGCAGGGTGCTGGTGGAGG - Intergenic
1054635294 9:67484554-67484576 CAGGGGCAGGGTGCTGGTGGAGG + Intergenic
1054891120 9:70253183-70253205 CAGCAGAAGCCTGCTGTATGGGG + Intergenic
1055244044 9:74218767-74218789 CAGCTGAAGCCTGCCCATGGAGG - Intergenic
1057048378 9:91903311-91903333 CAGGGGAAGCCAGCGGGTTGGGG - Intronic
1057261332 9:93586474-93586496 CAGGAGAAGCCAGCTGGGGGAGG + Intronic
1059064847 9:111072442-111072464 ACGCTGAGGCCTGCTGGTGGGGG - Intergenic
1060282031 9:122221334-122221356 CAGCGGCGGCCAGCTGTTGGGGG - Intronic
1187462714 X:19502207-19502229 CAGAGGAAGACTACAGGTGGGGG + Intronic
1190227934 X:48560316-48560338 ATGCTGAGGCCTGCTGGTGGAGG + Exonic
1191943435 X:66503872-66503894 CAGCTGATGTCTGCTGGTGTGGG + Intergenic
1192236385 X:69298892-69298914 CAGAGGCAGCATCCTGGTGGTGG - Intergenic
1192393214 X:70752977-70752999 CAGCTGACGCCTGCCCGTGGAGG + Intronic
1193175058 X:78383516-78383538 CAGCTGAAGCCTGCCCATGGAGG + Intergenic
1194532422 X:95068326-95068348 CAGCTGATGCCTGCTCATGGAGG + Intergenic
1198320071 X:135511645-135511667 CAGGGAAAGCCTCCTGGAGGAGG - Intergenic
1198579645 X:138049305-138049327 CAGGGGAAGGCTGCAGTTGGGGG - Intergenic