ID: 966905976

View in Genome Browser
Species Human (GRCh38)
Location 3:184525996-184526018
Sequence GCTCCCAGTAGAGCCTGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966905967_966905976 7 Left 966905967 3:184525966-184525988 CCCGTCAGGTCCGGACTGCGCCC 0: 1
1: 0
2: 0
3: 2
4: 41
Right 966905976 3:184525996-184526018 GCTCCCAGTAGAGCCTGCGCAGG 0: 1
1: 0
2: 1
3: 12
4: 117
966905973_966905976 -3 Left 966905973 3:184525976-184525998 CCGGACTGCGCCCTGGAGGGGCT 0: 1
1: 0
2: 1
3: 19
4: 192
Right 966905976 3:184525996-184526018 GCTCCCAGTAGAGCCTGCGCAGG 0: 1
1: 0
2: 1
3: 12
4: 117
966905968_966905976 6 Left 966905968 3:184525967-184525989 CCGTCAGGTCCGGACTGCGCCCT 0: 1
1: 0
2: 0
3: 5
4: 68
Right 966905976 3:184525996-184526018 GCTCCCAGTAGAGCCTGCGCAGG 0: 1
1: 0
2: 1
3: 12
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966905976 Original CRISPR GCTCCCAGTAGAGCCTGCGC AGG Intronic
900183939 1:1324431-1324453 GCTCCCACCAGGGCCCGCGCGGG + Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900266181 1:1758365-1758387 CCTCCCAGTAATGCCTGCACAGG - Intronic
901988108 1:13091881-13091903 CCTCCCAGCAGACCCTGCACAGG - Intergenic
901988250 1:13092478-13092500 CCTCCCAGCAGACCCTGCACAGG - Intergenic
901993562 1:13134289-13134311 CCTCCCAGCAGACCCTGCACAGG + Intergenic
901993704 1:13134886-13134908 CCTCCCAGCAGACCCTGCACAGG + Intergenic
903041087 1:20531235-20531257 GCTCCCATTTCAGCCTGCCCAGG + Intergenic
904001138 1:27339458-27339480 GCTTCCAGAAGAGGCTGAGCGGG + Intergenic
904608574 1:31712721-31712743 CCTCCCAGCAGTGCCTGGGCTGG + Intergenic
905590422 1:39158626-39158648 AATCCCAGTGGAGCCTGGGCTGG + Intronic
906144403 1:43551306-43551328 ACCCCCAGTGGAGCCTGAGCAGG + Intronic
907441564 1:54481735-54481757 GCTCCCAGGAGGGCCTGACCAGG + Intergenic
915047343 1:153029384-153029406 GCTCCCTGTAGACCCTACGAAGG - Intergenic
918216009 1:182392147-182392169 GCTCCCAGCAAAGCCCGCCCTGG + Exonic
923105286 1:230849492-230849514 CCTCCCAGCAGAGCCTCCGTGGG - Intronic
1075273046 10:121069597-121069619 GTTCCCAGAAGAGGATGCGCTGG - Intergenic
1075469854 10:122679964-122679986 GCTCCCAGTGGGGCCTGTGTTGG + Intergenic
1075872033 10:125778049-125778071 GCTCCGAGGAGAGCCAGCGGTGG - Intergenic
1076262226 10:129076139-129076161 GGGCCCAGAAGAGCCTGTGCAGG - Intergenic
1076306332 10:129467652-129467674 GCTTCCAGAAGCCCCTGCGCGGG + Intronic
1076380780 10:130023405-130023427 GCTCCCAGGACAGCCAGCCCCGG - Intergenic
1078268751 11:9775226-9775248 GCTCACAGCAGAGCCTGCGGGGG - Intergenic
1078580493 11:12535962-12535984 GCTGGCAGTAGAGCCTAGGCTGG - Intergenic
1079351125 11:19692986-19693008 GTTCCCTGTAGAGCCTGGGCAGG - Intronic
1082005787 11:47418304-47418326 GCTCCCAGTGGATCCTGTTCAGG + Intergenic
1083137310 11:60691517-60691539 GCTCCCAGCTGAGGCTGCTCTGG - Intergenic
1084546400 11:69817196-69817218 TCTCCCAATAGAGGCTGCGAGGG + Intronic
1085063970 11:73474918-73474940 GCTCCTAGTAGAGGCTTCTCTGG - Intronic
1085638513 11:78176593-78176615 ACCCCCAGAAGAGCCTGTGCTGG + Intronic
1088658457 11:112024836-112024858 GCAACCAGTACAGCCTGCGCGGG + Exonic
1090809036 11:130220754-130220776 GCTCCCCGTGGAGCCTGCCGTGG - Intergenic
1092255902 12:6926900-6926922 GCTCCCAGTAGAGCCGAGGAGGG - Intronic
1094829756 12:34294707-34294729 CTTCCCAGCAGAACCTGCGCAGG - Intergenic
1094831415 12:34301978-34302000 ATTCCTAGTAGACCCTGCGCGGG + Intergenic
1094832941 12:34308715-34308737 CTTCCCAGCAGACCCTGCGCGGG + Intergenic
1094836049 12:34322559-34322581 CCTCCCAGCAGCCCCTGCGCAGG - Intergenic
1097990381 12:65826026-65826048 GCTCCCCGTAGCCCCTGCCCCGG - Intronic
1102207546 12:111100865-111100887 GCCCCCAGTAGAGCCCTCCCTGG + Intronic
1102589941 12:113949455-113949477 GCACCTAGTAGTGCCTGTGCAGG - Intronic
1104383622 12:128329524-128329546 CCCCCCAGTAGATCCTGGGCTGG - Intronic
1105948712 13:25211063-25211085 ACTCCCAATAGAGCCCGCCCAGG + Intergenic
1107458072 13:40573390-40573412 GCTCCAAGTTGAGTCTGCCCTGG + Intronic
1122532057 14:102435150-102435172 GCTCCCAGCAGGACCTGAGCCGG + Exonic
1122744933 14:103891882-103891904 GCTCCCAGAAGCCCCTGCTCTGG - Intergenic
1124036883 15:26061990-26062012 GCTCCCAGTGGAGACTGTTCAGG + Intergenic
1124545909 15:30626360-30626382 GCGCCCAGTTGAGCCTGCTGGGG + Exonic
1124779427 15:32615747-32615769 GCGCCCAGTTGAGCCTGCTGGGG + Exonic
1129324456 15:74792806-74792828 GCTCCCAGTAGCCCTTGTGCTGG - Intronic
1130287056 15:82564822-82564844 GATCCCAGTAGAGTCTGGGGAGG - Intronic
1132365825 15:101255945-101255967 GTTCCCAGTAGTGCCTGTGCTGG - Intergenic
1132700538 16:1220325-1220347 CCACGCTGTAGAGCCTGCGCAGG - Exonic
1132729153 16:1352091-1352113 GCTCCCCGTAGGGCCCGCGCCGG + Exonic
1136524693 16:30821401-30821423 GCTTCCTGAAGATCCTGCGCAGG - Intergenic
1137506447 16:49057948-49057970 TCTCCCAGTAGAGCCTGCCCAGG + Intergenic
1139443143 16:66979155-66979177 GTTCCCAGTCCAGCCTGCCCAGG + Intergenic
1142186385 16:88696735-88696757 GCTCCCAGCAGAGGCGGGGCCGG - Exonic
1146062711 17:29615530-29615552 GCTCGCAGTCCAGCCTCCGCTGG + Exonic
1146893588 17:36525020-36525042 GCTTGCAGTAGAGCCTGGACTGG + Intronic
1147537336 17:41329135-41329157 GCTGTCAGGAGAGCCTGCACTGG - Intergenic
1151538018 17:74749488-74749510 GCTCCCAGCACAGCCTGGGAAGG - Intronic
1152812169 17:82387132-82387154 GCTCCCAGCAGAACCTCCGGCGG - Intergenic
1158960776 18:62586045-62586067 GTTCGCAGAAGAGCCTGCCCGGG - Intronic
1161183856 19:2902971-2902993 GCCCACAGTTGAGCCTGCACTGG + Intronic
1162096355 19:8312160-8312182 GCCCCCAGGAGACCCTGTGCCGG + Intronic
1163690829 19:18737288-18737310 GCTCCTGATACAGCCTGCGCCGG - Intronic
1163715649 19:18870633-18870655 GCTCCCAGGCTAACCTGCGCCGG - Intronic
1165100413 19:33435561-33435583 GGTCCCAGCAGGGCCTGCCCTGG + Intronic
1166258982 19:41625165-41625187 GCTCCCAGTAAGCCCTGCCCAGG + Intronic
1166351481 19:42200562-42200584 ACTCCCAGTAGAGCCAGCACAGG - Intronic
1167475903 19:49700874-49700896 GGTCCCAGGAGAGCCTGAGCAGG - Intronic
925885022 2:8388031-8388053 GCTCCCAGCATAGCTTGTGCTGG + Intergenic
926453849 2:13040296-13040318 GCTCCCAGTACAAACCGCGCTGG - Intergenic
929974214 2:46616615-46616637 GCACCCAGAGGAGCCTTCGCGGG + Intronic
932082149 2:68724932-68724954 GCTACCAGCAGAGCCTTTGCTGG + Intronic
932624151 2:73284538-73284560 GCGCCCAGCAGCGGCTGCGCCGG + Intergenic
933633503 2:84682290-84682312 GACCCCAGGAGAGCCTGCCCTGG - Intronic
933727229 2:85433833-85433855 GCTCCCCTTAGAGCATGGGCTGG + Intronic
941619442 2:167759586-167759608 GCTCTCAGTAGAGGCTTCTCTGG - Intergenic
948462010 2:238134338-238134360 GGTCCCAGGAGAGCCTGGGGTGG + Intergenic
948650514 2:239440618-239440640 GCTCCCAGGCGAGCCCGAGCTGG - Intergenic
1170150192 20:13220648-13220670 GCGCCCCGTAGAGCCTGGGAAGG - Intergenic
1170770574 20:19328894-19328916 GCTCCTCGCAGAGCCTGGGCTGG - Intronic
1171306716 20:24112955-24112977 GCTCCCTGGAGAGCGTGTGCAGG - Intergenic
1171408962 20:24933481-24933503 GCTCCCAGGAGAGGCTGGGAGGG - Intergenic
1173048190 20:39532660-39532682 GCTCCCAGGAGAAACTGGGCAGG - Intergenic
1173664148 20:44753282-44753304 CCTCCCAATAGAGGCTGAGCCGG - Intronic
1179044566 21:37832754-37832776 GCTCCCAGTGGAGCCCCCACTGG - Intronic
1180176565 21:46093325-46093347 GCTCTCAGGAGAGCCTGTGCTGG + Intergenic
1182761409 22:32725248-32725270 GATCCCAGTAAAGCATGCCCTGG + Intronic
950633272 3:14298118-14298140 GCTTCCTGGAGAGCCTGTGCTGG + Intergenic
954882338 3:53844628-53844650 GCTCACAGCAGGGCCTGCCCTGG + Intronic
957707846 3:83813335-83813357 GCTCACAGTAGATCCTGGGAAGG - Intergenic
961571855 3:127804889-127804911 GTTCCCAGCAGAGCCTGTGCTGG - Intronic
966905976 3:184525996-184526018 GCTCCCAGTAGAGCCTGCGCAGG + Intronic
968469748 4:773954-773976 TCACCCAGTGGATCCTGCGCTGG - Intergenic
969595090 4:8144174-8144196 GCACCCAGCAGAGCCTCAGCGGG + Intronic
969927771 4:10601251-10601273 GCTTCCAGCTGGGCCTGCGCTGG - Intronic
985634168 5:1027855-1027877 GCTCCCAGAGGTGCCTGCACCGG + Intronic
985893213 5:2732450-2732472 GCTGCCAGTAGGACCTGAGCGGG + Intergenic
986111378 5:4721699-4721721 GCTCCCAGGAAAGCCTGGGAAGG - Intergenic
996457091 5:123697097-123697119 GCTCCCAGTTGGGCCTGGGTTGG + Intergenic
998446713 5:142204481-142204503 GCTCCCAGTAGTGCCCCAGCTGG - Intergenic
998951323 5:147395620-147395642 GCCCCGAGCAGAGCCTGCGGGGG + Exonic
1002442931 5:179273734-179273756 GCTGCCTGTAGAGTCTGGGCTGG - Intronic
1002786095 6:401668-401690 CGTCCCAGTAGATCCTGCTCTGG - Exonic
1011197073 6:84792554-84792576 GCTCCCAGCACAGCCTAAGCAGG + Intergenic
1015928704 6:138335124-138335146 GCTCCCGGTGGAGCCTGAGCGGG - Exonic
1017205457 6:151800294-151800316 GCTCTCAGAAGAGCCTGAGCAGG + Intronic
1018031513 6:159845296-159845318 CCTCCCAGGAGAGCCGGCACTGG - Intergenic
1022717805 7:32914571-32914593 GAACCCAGTTGAGCCTGCTCAGG - Intergenic
1022737780 7:33092171-33092193 GAGCCCAGTTGAGCCTGCTCAGG - Intergenic
1024055941 7:45659915-45659937 ACTCCCCGTGGAGCCTGCCCTGG + Intronic
1026896168 7:74011182-74011204 GCCCGCAGTAGAGCCTGCAGAGG + Intergenic
1029570025 7:101363151-101363173 GCTGCCAGGGGAGCCGGCGCCGG - Exonic
1030292728 7:107888245-107888267 TCACCCAGTGGATCCTGCGCTGG - Intergenic
1032853221 7:135812971-135812993 GCTCCCAGTAGGGACTGGGGTGG - Intergenic
1035059756 7:156060180-156060202 GCTCCAAGTACAGCTTCCGCTGG - Intergenic
1044043926 8:87405824-87405846 GCTCACAGTAGAATCTGTGCTGG - Intronic
1049599299 8:143499676-143499698 GCTCACAGTAGAGCCAGCACCGG + Intronic
1053723766 9:40975456-40975478 GCCCCCAGCAGGGCCAGCGCAGG - Intergenic
1054342194 9:63876543-63876565 GCCCCCAGCAGGGCCGGCGCAGG + Intergenic
1055007510 9:71525436-71525458 GCTCCCAGGACAGCCGGCACAGG + Intergenic
1057817028 9:98303496-98303518 TCTCCCAGCAGATCCTGCTCTGG + Intronic
1061708416 9:132470655-132470677 GCCCACAGTAGAGCCATCGCAGG + Intronic
1061922289 9:133788787-133788809 ACTCCCAGTTGATCCCGCGCTGG + Intronic
1061937658 9:133867152-133867174 GCTCCCTGCAGAGCCGGGGCAGG + Intronic
1189869422 X:45366985-45367007 GCTTCCAGTACAGCCTGTACAGG - Intergenic
1192441844 X:71180338-71180360 GCACCCAGAAGAGCCTGAGTGGG - Intergenic
1195084524 X:101401735-101401757 ACTCCCAGGGAAGCCTGCGCAGG + Exonic
1201232567 Y:11879493-11879515 TCTCCTAGTGGATCCTGCGCCGG + Intergenic