ID: 966907263

View in Genome Browser
Species Human (GRCh38)
Location 3:184536095-184536117
Sequence ATTCACATGAGGCCCCTAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 68}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966907259_966907263 5 Left 966907259 3:184536067-184536089 CCACTGCCTTAGCACAAAAATGT 0: 1
1: 0
2: 1
3: 13
4: 182
Right 966907263 3:184536095-184536117 ATTCACATGAGGCCCCTAATGGG 0: 1
1: 0
2: 0
3: 2
4: 68
966907260_966907263 -1 Left 966907260 3:184536073-184536095 CCTTAGCACAAAAATGTTTCTCA 0: 1
1: 0
2: 5
3: 65
4: 683
Right 966907263 3:184536095-184536117 ATTCACATGAGGCCCCTAATGGG 0: 1
1: 0
2: 0
3: 2
4: 68
966907256_966907263 14 Left 966907256 3:184536058-184536080 CCCTAAATCCCACTGCCTTAGCA 0: 1
1: 0
2: 5
3: 13
4: 214
Right 966907263 3:184536095-184536117 ATTCACATGAGGCCCCTAATGGG 0: 1
1: 0
2: 0
3: 2
4: 68
966907257_966907263 13 Left 966907257 3:184536059-184536081 CCTAAATCCCACTGCCTTAGCAC 0: 1
1: 0
2: 2
3: 18
4: 249
Right 966907263 3:184536095-184536117 ATTCACATGAGGCCCCTAATGGG 0: 1
1: 0
2: 0
3: 2
4: 68
966907258_966907263 6 Left 966907258 3:184536066-184536088 CCCACTGCCTTAGCACAAAAATG 0: 1
1: 0
2: 1
3: 15
4: 188
Right 966907263 3:184536095-184536117 ATTCACATGAGGCCCCTAATGGG 0: 1
1: 0
2: 0
3: 2
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966907263 Original CRISPR ATTCACATGAGGCCCCTAAT GGG Intronic
903171494 1:21557247-21557269 ATTCCCATGATGACCCTAAGCGG - Intronic
910264021 1:85319699-85319721 ATTCACAGGATGCACATAATTGG + Exonic
917926278 1:179791507-179791529 ATGTACATGAGGCTCCTAAGGGG + Intronic
918749104 1:188248444-188248466 ATTCAAGTGAGGTACCTAATGGG + Intergenic
1064606830 10:17050690-17050712 ATTCAAATGAGACACCTAAAAGG + Intronic
1066113841 10:32222229-32222251 ATTCACTTGAGGCTGCCAATGGG + Intergenic
1073376126 10:103036410-103036432 ATGCAAATGAAGTCCCTAATGGG - Intronic
1073458891 10:103654169-103654191 AATCCCATGAGGCCACCAATGGG + Intronic
1074035771 10:109736903-109736925 ATTCACTTGAGGCCCTTTAAGGG - Intergenic
1079483879 11:20913444-20913466 ATACACAAGAGGGACCTAATTGG + Intronic
1084928787 11:72536707-72536729 ATTCACATCAGGCCAAAAATTGG - Intergenic
1089621011 11:119722220-119722242 ATTCACATGGGGCTCCTGAGAGG + Intronic
1090744041 11:129692642-129692664 ATTCACCTGAGGTCCCAGATGGG - Intergenic
1092209901 12:6639346-6639368 CTTGACATCAGGCCACTAATCGG - Intronic
1092764090 12:11836910-11836932 CTTCACATGTGTCCCCTAATGGG + Intronic
1097703818 12:62847104-62847126 TTTCACAGAAGGGCCCTAATTGG - Intronic
1100721387 12:97362572-97362594 ATTCCCATGAGGCCCCAGTTGGG + Intergenic
1100734357 12:97510914-97510936 ATTCACATGGAGTCCATAATTGG + Intergenic
1102211943 12:111133653-111133675 ATTCCCAGCAGGCCCCTAAAGGG - Intronic
1102217882 12:111174484-111174506 AGTCACATGCAGCCCCTAGTTGG + Intronic
1108712095 13:53043577-53043599 TTTCCCCTGAGGCCCCTGATAGG - Intronic
1109988520 13:70021694-70021716 CTTCACTTGAGGCACCTATTAGG - Intronic
1110475428 13:75907857-75907879 TTTCACCTGAGGCCTCTGATGGG + Intergenic
1123963067 15:25427005-25427027 AGTCACTTGAGGCCACGAATTGG - Intronic
1124391276 15:29260120-29260142 ATTCACCAGAGACCCCAAATAGG - Intronic
1142267284 16:89070531-89070553 AGCCACATGTGGCCCCTGATGGG + Intergenic
1145235966 17:21208668-21208690 ATCCACATTAGGCCCCTTCTTGG + Intronic
1146531025 17:33607856-33607878 ACTCAAATGAAGACCCTAATAGG + Intronic
1157059409 18:44270094-44270116 ATTTACATTAGGCCTCTATTAGG - Intergenic
929234410 2:39591058-39591080 ATTTACATGAGTCCCCCCATTGG - Intergenic
930453221 2:51570902-51570924 ATTCATATGATGCTCCTTATTGG + Intergenic
941670837 2:168290762-168290784 TTTAACATGAGGCCTGTAATAGG - Intergenic
943169835 2:184384705-184384727 AATCACATGAGGCCCTAAAGTGG - Intergenic
944203446 2:197133100-197133122 CTTCACATGATGACACTAATCGG + Intronic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
1168809054 20:691572-691594 ACTGACATGAGGCTCCTGATGGG + Intergenic
1170039366 20:12023906-12023928 ATTCACATGAGGACCCTCTCTGG - Intergenic
1170697662 20:18674545-18674567 GGTCACATGTGGCCCCAAATTGG - Intronic
950769941 3:15303290-15303312 ATTCACATTAGCTCTCTAATCGG + Intronic
951792452 3:26501379-26501401 ATTAAAATGAGGGCACTAATTGG + Intergenic
955152054 3:56377086-56377108 ATTAACATTGGGCCTCTAATCGG - Intronic
955609064 3:60738350-60738372 ATACACAGGAGGCCCCAAAATGG + Intronic
966907263 3:184536095-184536117 ATTCACATGAGGCCCCTAATGGG + Intronic
967447857 3:189587793-189587815 ATTAACATGAGGCCCCAAGAGGG + Intergenic
968641984 4:1719658-1719680 ATTCACTTGTGGTCCCTCATAGG + Intronic
970435097 4:16025642-16025664 ATTCACATGAGGACAGGAATGGG - Intronic
970628412 4:17915202-17915224 CTTCACATGAGCCACCTCATGGG - Intronic
972775965 4:42240796-42240818 AGTCTCTTGAGGCCCCTGATTGG + Intergenic
980098364 4:128516935-128516957 ATTTAAATGAGGCCCTTAAAGGG + Intergenic
980784181 4:137531252-137531274 ATCCAGATGAGGGCGCTAATGGG - Exonic
982934600 4:161456326-161456348 ATCCACCTGAGGACACTAATTGG + Intronic
991293063 5:65051325-65051347 ATTCTCATGGGGCCCCACATGGG - Intergenic
1008411264 6:51182848-51182870 TTTCAAATGAGGTCCCTTATTGG + Intergenic
1011730385 6:90256541-90256563 ATTCACATGAGGTCTTAAATGGG - Intronic
1012054697 6:94391640-94391662 CTTCACTTGAGGCACATAATGGG - Intergenic
1016374297 6:143404736-143404758 ATTCACACTAGGCCCCAAGTGGG + Intergenic
1017188871 6:151630405-151630427 ATTAATATGAGGCCCTTAATAGG + Intergenic
1021053988 7:16024376-16024398 ATACATACGAGGCCCCAAATAGG - Intergenic
1023522412 7:41061436-41061458 ATCCACATGAAGCCCCCAAAAGG - Intergenic
1025144832 7:56493919-56493941 CTGCACAGGAGGCCACTAATGGG + Intergenic
1025816191 7:64914449-64914471 AATCACATGAGGCACTTATTAGG - Intronic
1038266991 8:26045438-26045460 ATGCAAATGAGGCTCCTTATCGG - Intergenic
1041958401 8:63582916-63582938 ATCCACATGAGGCTCCAAACTGG - Intergenic
1044441132 8:92225493-92225515 ATTCAGGTGAGGCTCCTATTTGG - Intergenic
1046363886 8:113200042-113200064 ATTCCCATGAGGCATCTAAATGG - Intronic
1051977573 9:22970615-22970637 AAACATATGAGGCCTCTAATTGG + Intergenic
1057710374 9:97436383-97436405 ATTCACATAAGACCTATAATGGG - Intronic
1058637491 9:107050470-107050492 ATTTACATGATGCCTCTATTAGG + Intergenic
1190783624 X:53622468-53622490 ATTCTGATGAGGCCCAGAATAGG - Intronic
1193168365 X:78307493-78307515 ATTCAGATGAGCCCTTTAATAGG - Intronic
1200961669 Y:9001596-9001618 GTTCACATGTGCCCCCTCATAGG - Intergenic