ID: 966907949

View in Genome Browser
Species Human (GRCh38)
Location 3:184541371-184541393
Sequence GTGAGGAGGAATCAAGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966907945_966907949 -5 Left 966907945 3:184541353-184541375 CCACCTAGATGGGGCTTGGTGAG 0: 1
1: 0
2: 1
3: 6
4: 116
Right 966907949 3:184541371-184541393 GTGAGGAGGAATCAAGCTGCTGG 0: 1
1: 0
2: 1
3: 11
4: 205
966907947_966907949 -8 Left 966907947 3:184541356-184541378 CCTAGATGGGGCTTGGTGAGGAG 0: 1
1: 1
2: 2
3: 22
4: 232
Right 966907949 3:184541371-184541393 GTGAGGAGGAATCAAGCTGCTGG 0: 1
1: 0
2: 1
3: 11
4: 205
966907939_966907949 30 Left 966907939 3:184541318-184541340 CCGAGCAGGTTGGAATTTAAGGG 0: 1
1: 0
2: 0
3: 13
4: 123
Right 966907949 3:184541371-184541393 GTGAGGAGGAATCAAGCTGCTGG 0: 1
1: 0
2: 1
3: 11
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966907949 Original CRISPR GTGAGGAGGAATCAAGCTGC TGG Intronic
900308984 1:2024462-2024484 GTGAGGAGGAGGCAAGGGGCAGG - Intronic
901664809 1:10820094-10820116 GTGAGGAGGAAACAAGGTGGAGG + Intergenic
902267765 1:15280467-15280489 CTGAGGAGGAAGCAAACTTCAGG - Intronic
902597816 1:17521034-17521056 GGGAGGAGGAATGCAGCTGGTGG + Intergenic
903238839 1:21968910-21968932 CTGAGGAGGAAGCCAGCAGCCGG + Intergenic
903242760 1:21994574-21994596 CTGAGGAGGAAGCCAGCAGCCGG + Intronic
904157695 1:28498317-28498339 GTGAAGAGGAAGCACGCAGCAGG - Exonic
907051228 1:51330771-51330793 GTGAGGAGGGAGCGAGCTCCCGG - Intronic
908719544 1:67109606-67109628 ATGAGCATGAATCAAACTGCTGG + Intronic
910118869 1:83761976-83761998 TTTAGGAGGAATCAAGCCGGTGG - Intergenic
910266765 1:85346181-85346203 GTGAGAAGTAATCAAGCTTTCGG + Intronic
911566200 1:99465841-99465863 CTGAGGAAGAATCTAGCTTCTGG - Intergenic
914724234 1:150313996-150314018 GGGAGGAGGAATCAAGGATCAGG - Intergenic
921517338 1:216111858-216111880 TTGAGTAGGAATGAAGCTGAAGG - Intronic
922931129 1:229390585-229390607 GTGAAGAGGAATCCAGCAGTGGG + Intergenic
924738658 1:246781517-246781539 GTGAGGAGGAAGACAGCGGCAGG - Intergenic
1063400340 10:5737567-5737589 GTGGGGATAAATCTAGCTGCAGG - Intronic
1064850651 10:19705630-19705652 AGGAGGAGGAATCATGCTGGTGG - Intronic
1070552467 10:77501598-77501620 GGGAGGAGGAATCAGGCTGGGGG - Intronic
1071576417 10:86730003-86730025 GTGTGGAGGCCTCAAGCTGCTGG - Intronic
1072229979 10:93406547-93406569 GTGGGGAGGAGGCAAGATGCTGG - Intronic
1072756936 10:98027838-98027860 GTGAAGAGGAAGCAGGCCGCTGG + Intronic
1072916383 10:99539668-99539690 GTCAGGAGGAATCAAAATCCAGG + Intergenic
1075345697 10:121680582-121680604 GTCTGGAGGAAGCAGGCTGCTGG - Intergenic
1075685992 10:124365496-124365518 GTGAGGATGAATGAGGGTGCTGG + Intergenic
1076021364 10:127076644-127076666 GTGAGGAGAAATCAGGGTGCTGG - Intronic
1076053708 10:127354491-127354513 AGGAGGAGGAATCTAGCTGGGGG - Intronic
1077454312 11:2669171-2669193 GTGAGAAGGAAGCAAGGTCCTGG - Intronic
1078423647 11:11232286-11232308 GGGAGGATAAATGAAGCTGCAGG + Intergenic
1081446232 11:43133936-43133958 CTGAGGAGGAATGAGGCTGAAGG - Intergenic
1081684393 11:45031830-45031852 GTCAGGAGGAATGAAGGTACTGG - Intergenic
1083383910 11:62293248-62293270 GGGAGGAGGAATGTAACTGCAGG - Intergenic
1085263584 11:75223448-75223470 GAGAGGAGGATTCCAGCTACTGG - Intergenic
1085924903 11:81005694-81005716 CTGAGGAGGAGACAAGCTGAAGG + Intergenic
1086001059 11:81986785-81986807 GTGGGGAGGGCTCAGGCTGCAGG + Intergenic
1087833307 11:102843664-102843686 GCAAGGATGAGTCAAGCTGCGGG - Exonic
1088232559 11:107687756-107687778 GAGAGGAGGAATGGATCTGCAGG - Intergenic
1088637517 11:111837470-111837492 GTCAGGAAGAAGGAAGCTGCTGG + Exonic
1089031183 11:115331005-115331027 AAGAGGAGGAATCAGGTTGCAGG + Intronic
1089843968 11:121443850-121443872 TGGAGGAGGAATCAGCCTGCTGG - Intergenic
1090381011 11:126327921-126327943 GTGAAGAGGAAGCAAGCTGGTGG + Intronic
1091028313 11:132161149-132161171 GTGAGGAGGAGTTGAGCTCCTGG + Intronic
1091108359 11:132943375-132943397 GAGAGGAAGAAGCAAGGTGCGGG + Exonic
1091658447 12:2363024-2363046 GTGAGTAGGTATCAGGCAGCTGG + Intronic
1093212940 12:16329004-16329026 AGGAAGAGGAATCCAGCTGCTGG + Intergenic
1096114793 12:49049659-49049681 GTGAGGGGCTATCTAGCTGCGGG - Intronic
1097465521 12:59919939-59919961 GTGAGGAGGAGCAAAGTTGCTGG - Intergenic
1098389006 12:69949482-69949504 GAAGGGAGGAATCAGGCTGCTGG - Intronic
1102822491 12:115919970-115919992 GTGTGCAGAAATCAAGTTGCAGG + Intergenic
1104805475 12:131586718-131586740 GACAGGAGAAATCAAGCAGCTGG - Intergenic
1105888985 13:24668576-24668598 GTCAGGAGGAGTCAGGCTGGGGG - Intergenic
1106143710 13:27033703-27033725 GTGAGTAGGACTCATGGTGCTGG + Intergenic
1106334094 13:28766725-28766747 GAGAGGAGGAGTCAAGGTTCAGG + Intergenic
1106474505 13:30086514-30086536 AGGAGAAGGAATCACGCTGCAGG + Intergenic
1108684322 13:52805545-52805567 GGGACTAGGAATCAAGCAGCTGG + Intergenic
1112654756 13:101439152-101439174 CAGAGGAGGTAACAAGCTGCTGG + Intergenic
1113672105 13:112182499-112182521 GTGAGGGGGAGTCACGCAGCTGG - Intergenic
1113831455 13:113298467-113298489 GTGATGTAGAATCAAGCTGGGGG + Intronic
1114544212 14:23486655-23486677 CTGAGGGGCAACCAAGCTGCCGG - Intronic
1116922177 14:50590395-50590417 GGGAGGAGGAAGCAAGTAGCAGG - Intronic
1120422761 14:84309139-84309161 GTGAGGAGGTATCCATTTGCAGG + Intergenic
1121780885 14:96621878-96621900 GAGGGGAGGAATCAAGGTGCTGG - Intergenic
1122028699 14:98896643-98896665 GTGTGGAAGAACAAAGCTGCAGG + Intergenic
1122856402 14:104562306-104562328 GTGAGCAGGAATCAAGGCCCAGG + Intronic
1123220873 14:106854326-106854348 GTGAGGTGGAAACAGGCTGTTGG + Intergenic
1124197451 15:27644806-27644828 GGGAGGAGGAGCAAAGCTGCTGG - Intergenic
1124353565 15:28978289-28978311 GTGTGGAGGAGCCAAGTTGCAGG - Intronic
1127315690 15:57791956-57791978 GTGAGGAGGGTGCAAGCTGGGGG - Intergenic
1128669335 15:69562835-69562857 GTGAGGAGGAGTCAAGGTCTGGG + Intergenic
1128737744 15:70062833-70062855 GTGGGAATGAATCAAGATGCTGG - Intronic
1129670561 15:77605636-77605658 GTGTGGAGGCAAAAAGCTGCAGG - Intergenic
1129889489 15:79062315-79062337 GTGAGGAAGAACCCAGATGCAGG - Intronic
1131445467 15:92495206-92495228 GTGGGGAGGAATCATGTGGCAGG - Intronic
1132020805 15:98360374-98360396 GTGGGGAGGCATCATGTTGCAGG - Intergenic
1133436427 16:5784123-5784145 GTGAAGAGGAAGCAGGCAGCCGG + Intergenic
1133522355 16:6571301-6571323 GGGAGGAGCAAGGAAGCTGCAGG + Intronic
1134202632 16:12211412-12211434 GTTAGAAGGAAAAAAGCTGCAGG - Intronic
1134815856 16:17205386-17205408 GGGAGGAGAAAGCAAGGTGCAGG + Intronic
1135905659 16:26509536-26509558 TTGAGGCCAAATCAAGCTGCAGG + Intergenic
1136244063 16:28963326-28963348 GTGAGGATGAGTCGAGCTGGAGG - Intronic
1140061834 16:71577198-71577220 GAGAGGAGGAAAGAAGCTGAGGG - Intergenic
1140933003 16:79645122-79645144 GTTACGAGGATTCAAGCTGGAGG + Intergenic
1141432742 16:83979276-83979298 GTGATGAGGACCCAAGCTTCTGG + Intronic
1141784152 16:86187356-86187378 GTGAGGAGCTACAAAGCTGCTGG - Intergenic
1144058174 17:11559551-11559573 GCTAGGAGGAATAAAGTTGCAGG - Exonic
1146127472 17:30240243-30240265 GTGAGGAGAAATCAGGGTGTAGG + Intergenic
1147717252 17:42516718-42516740 CTGAGGAGGAAGCAATCTTCTGG - Intronic
1147788469 17:42997523-42997545 GTGAGGATTAAACAGGCTGCCGG + Intergenic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150435010 17:65146983-65147005 CTGAGGAGGCAACAGGCTGCAGG - Intronic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1152315780 17:79579572-79579594 GAGAGGAGGAGGCAAGCTCCGGG + Intergenic
1155161237 18:23197492-23197514 GTGCGGAGGAGCCAAGCTGAGGG + Intronic
1157584800 18:48794161-48794183 GAGAGCAGGAACCAAGCTGGGGG - Intronic
1157751391 18:50181752-50181774 GTGACTATGAAACAAGCTGCAGG - Intronic
1159551600 18:69901177-69901199 GTGGAGAGGAATCAACCTACAGG + Intronic
1160600737 18:80010778-80010800 GTGGGGGGAAATCAGGCTGCAGG - Intronic
1164593195 19:29517408-29517430 GTTAGGAGGAAGCAAGCAGGAGG + Intergenic
1164752375 19:30666304-30666326 GTGAGAAGGAACCCAGCAGCAGG - Intronic
1167114458 19:47480509-47480531 TCCAGGAGGAATCAAGCAGCAGG - Intronic
925014997 2:516325-516347 GCGAGGAAGAAACCAGCTGCAGG - Intergenic
927668629 2:25050249-25050271 GTGAAGTGAAATCAAGCTGGGGG + Intronic
927930292 2:27039529-27039551 GTGTGCAGGAATGCAGCTGCCGG - Intronic
928430891 2:31217597-31217619 GTGGGGAGGAACCAAGGTCCTGG - Intronic
928951745 2:36819424-36819446 GTGAGAAGGGATCAAGTTTCTGG - Intergenic
930434206 2:51319126-51319148 GAGAGTAGGAATTAAGCTACAGG + Intergenic
934711851 2:96521334-96521356 CTGAGGTGGAATCAGGCGGCAGG - Intergenic
937831343 2:126427709-126427731 GTGAGCAGGAAGCCAGCTGTGGG - Intergenic
938867537 2:135438605-135438627 GTGAGAAGGGATCAAGATGGAGG - Intronic
940073794 2:149718512-149718534 GTGAGGAGGGGTCAGGCTGGAGG + Intergenic
940175790 2:150876645-150876667 GTCAGGAGGAGGCAAGCTGGAGG + Intergenic
940454217 2:153874673-153874695 GGGAGGTGGAATTTAGCTGCAGG - Intronic
940845972 2:158642494-158642516 GTTAGGGGGAATCAAGCATCTGG + Exonic
944972147 2:205005306-205005328 GTGAGGATGAAGAAAGCTGAAGG + Intronic
945384345 2:209179325-209179347 GTTATGGGGAATCAAGCTTCTGG + Intergenic
947371434 2:229450707-229450729 GTGAGGAGGAAGCAAGAGGGTGG + Intronic
948312551 2:236999620-236999642 GTGAGCATGAATCAGGCCGCGGG - Intergenic
948403331 2:237700274-237700296 CTAAGAAGGAATCAAGCTCCTGG - Intronic
948655861 2:239476374-239476396 GGAAGGAGGGATCCAGCTGCGGG + Intergenic
1170464421 20:16609907-16609929 GTGAGGAAGAGGCAACCTGCAGG - Intergenic
1174543859 20:51310307-51310329 GGGAGGAGGAGTCAGGCTGGTGG + Intergenic
1175445335 20:59015915-59015937 GTGAGCAGGATCCAGGCTGCTGG - Intergenic
1175474621 20:59262822-59262844 GTAAGGAGAAATGAGGCTGCTGG - Intergenic
1175768420 20:61606991-61607013 CTGAGGAGGGATAGAGCTGCTGG + Intronic
1177943541 21:27440491-27440513 TTGGAGAGGAATCCAGCTGCTGG + Intergenic
1179250921 21:39670528-39670550 GTAAGGTGGAAGCCAGCTGCAGG + Exonic
1179598532 21:42460318-42460340 GTGATGAAGAATCAAATTGCAGG + Intergenic
1180179684 21:46112370-46112392 CTGCGGGGGCATCAAGCTGCAGG + Exonic
1182037916 22:27213880-27213902 GTGACGTGGAATGAACCTGCAGG + Intergenic
1182422031 22:30253404-30253426 GTAGGGAGGAAGCCAGCTGCTGG - Intergenic
1183296649 22:37033799-37033821 TTCAGGAGGAATCGAGTTGCGGG - Intergenic
1184195138 22:42922595-42922617 GTGAAGAGGAAACGAGCTGCAGG - Intronic
1184267545 22:43357284-43357306 GTGAGGATCAAACAAGCTGATGG - Intergenic
952404408 3:32992709-32992731 GTTTGGAGGAATGAAGCTGGTGG + Intergenic
952833256 3:37583041-37583063 GTGAGGAAGACTCAGCCTGCGGG - Intronic
954101014 3:48372630-48372652 GTGCGGTAGAAACAAGCTGCAGG - Intronic
954775254 3:53011354-53011376 GGCAGGAGGGATCAATCTGCTGG + Intronic
954886882 3:53882395-53882417 GTGAGGACGAAATAAGATGCGGG - Intergenic
955033010 3:55238882-55238904 GGGAAAAGGAATCAAGCAGCAGG + Intergenic
955659225 3:61278615-61278637 GTGAGGAAGAAGCAAGCAGGTGG - Intergenic
960335939 3:116417570-116417592 CTGAAGAGGAATCGACCTGCTGG + Intronic
960727187 3:120682365-120682387 GTGAAGAGGAACCAAGCCTCTGG - Exonic
961634458 3:128324070-128324092 GTGAGGATGAATTCAGCTGAGGG - Intronic
966425155 3:179772991-179773013 ATGAGGGGAAATCAAGCTGTTGG + Intronic
966754411 3:183355219-183355241 GTGAGGAGGAAGCAAGAGACAGG + Intronic
966907949 3:184541371-184541393 GTGAGGAGGAATCAAGCTGCTGG + Intronic
967237036 3:187395380-187395402 GTGAAAAGGAGTCAAGCTGGTGG - Intergenic
969039673 4:4286232-4286254 TTGAGGTGTAATCAAGGTGCTGG - Intronic
971485687 4:27157658-27157680 GTGAGGAGGAGTCGAGGAGCCGG + Intergenic
975803084 4:78083145-78083167 TTGAGGAGGCTTCATGCTGCAGG + Intronic
976553964 4:86429139-86429161 GTGCTGAGGAAGCAAGCGGCAGG - Intronic
977577883 4:98694076-98694098 GGGAGGAGGAATCAAACGTCCGG + Intergenic
981129483 4:141142474-141142496 GGGAGGAGGAATGAAGTTGTTGG - Intronic
982201842 4:152969174-152969196 GTGAGGTGGAATCATGTAGCAGG + Intronic
982629604 4:157815306-157815328 GTGATGAGTGATCACGCTGCAGG - Intergenic
982678316 4:158400787-158400809 GGGAGGAGGACAGAAGCTGCTGG + Intronic
983657220 4:170095296-170095318 GGGATGAGGAGTCAATCTGCTGG + Intergenic
984951580 4:185011664-185011686 ATGGGCAGGAGTCAAGCTGCAGG - Intergenic
986173592 5:5333255-5333277 GATAGGAGGAAAAAAGCTGCTGG + Intergenic
991963854 5:72072123-72072145 GTAAGGAAGAAGCAAGCAGCTGG + Intergenic
994232387 5:97322918-97322940 CTGAGGAGGAGTCTACCTGCAGG + Intergenic
995033931 5:107512403-107512425 GTGAGGAAGAAACAAGGTGGGGG - Intronic
995220620 5:109643567-109643589 ATGAGGATCAATCAATCTGCAGG - Intergenic
995525557 5:113047955-113047977 GTAAGCAGGAATCAGCCTGCCGG - Intronic
998092810 5:139380931-139380953 GGGAGGAGGGATAAAGATGCGGG + Intronic
998590856 5:143476543-143476565 GTGAAGAGGAAGCATTCTGCTGG + Intergenic
999102252 5:149036380-149036402 GAGAGGAAGAAACAAGCTGCGGG - Intronic
1001835133 5:174825199-174825221 GTGAGGGGGAGTCAGGCTGGTGG - Intergenic
1004401692 6:15294566-15294588 GTGAGGAGGAGTGAAAGTGCAGG + Intronic
1005857010 6:29870331-29870353 GCCAAGAGGACTCAAGCTGCAGG + Intergenic
1005874327 6:29999668-29999690 GCCAGGAGGACTCAAGTTGCAGG + Intergenic
1005877240 6:30020470-30020492 GTGAGCAGGAATACAACTGCTGG + Intergenic
1006429013 6:33983788-33983810 GGCAGGAGGAACCAAGCTGTGGG + Intergenic
1006875485 6:37291826-37291848 GTGGGGAGAAATCAAGGTCCTGG - Intronic
1007663838 6:43502956-43502978 TTGAGCAGGGAGCAAGCTGCAGG - Intronic
1009436054 6:63619723-63619745 GGGAGAAGGAGTCTAGCTGCTGG - Intergenic
1011381747 6:86749748-86749770 GAGAGGAGGAGTCCAGCTGGTGG - Intergenic
1012116761 6:95309477-95309499 CTGAGTAGGAATCAAGCTTATGG + Intergenic
1014226056 6:118848326-118848348 GTGAGGAGAAATGAGGCTGTAGG + Intronic
1016154428 6:140786232-140786254 AAGAGGAAGAATCAAGCTGGAGG + Intergenic
1017564164 6:155666365-155666387 GTGAGGTGGAGTCAAGCTGCAGG + Intergenic
1023352762 7:39336584-39336606 CTGAGGAGGAAGGAAGCAGCAGG - Intronic
1024808157 7:53173617-53173639 TTGAGAAGGAATAAAGCTGGGGG - Intergenic
1025000132 7:55309072-55309094 GTGAGGAGGAAATGAGCTGGTGG - Intergenic
1025000149 7:55309171-55309193 GTGAGGAGGAAATGAGCTGGTGG - Intergenic
1028742654 7:94293580-94293602 GTGTGCAGGAATACAGCTGCAGG + Intergenic
1029546869 7:101215066-101215088 GTGAGGAGGAAGACAGCCGCAGG - Intronic
1029845816 7:103411231-103411253 GTGACGAGCAAGCAAGCTTCAGG - Intronic
1035277038 7:157753937-157753959 ATGAGGAGGGAGCAAGATGCTGG - Intronic
1037974715 8:23201051-23201073 GTTAGGAGGAATCACACTCCAGG + Intronic
1038195852 8:25366920-25366942 GTGAGAAGGTTTCAAGCTGAAGG - Exonic
1040306260 8:46213432-46213454 GTGTGGTGTAAGCAAGCTGCAGG + Intergenic
1041093418 8:54326033-54326055 ATGAGGAGGAATGAAGCTATAGG - Intergenic
1043575702 8:81653479-81653501 GTGCAGAGGAATGAAGCTGCTGG + Intergenic
1048133142 8:131719603-131719625 GTGAGGAGAAATATAGCTGGAGG + Intergenic
1048219054 8:132524808-132524830 CTGAGCAGGAATAAAGCTGGAGG - Intergenic
1048713050 8:137233436-137233458 GTGAGGAGGACTCACTCAGCGGG + Intergenic
1049799300 8:144510372-144510394 GAGAAGAGGAAACAGGCTGCTGG - Exonic
1053412042 9:37922196-37922218 GTGTGCAGGTATGAAGCTGCAGG + Intronic
1053584543 9:39443123-39443145 GTGAGGAGGCATCATGATGTTGG + Intergenic
1054106123 9:61001869-61001891 GTGAGGAGGCATCATGATGTTGG + Intergenic
1057416548 9:94868902-94868924 GAGAGGAAAAAACAAGCTGCAGG - Intronic
1061010963 9:127954422-127954444 GTCAGGAGGAACCAGGCTTCAGG - Intronic
1061445236 9:130633783-130633805 GTGGGGAAGAAGCAAGCAGCGGG - Intronic
1062658219 9:137614950-137614972 TGGAGGAAGAATCAAGGTGCTGG - Exonic
1203452231 Un_GL000219v1:129721-129743 TTGAGGAAGAACAAAGCTGCAGG + Intergenic
1186314231 X:8351367-8351389 CTGAGCTGAAATCAAGCTGCTGG + Intergenic
1186513709 X:10150277-10150299 GTGAGGAGGCAGCAAGCTGAGGG - Intergenic
1189926225 X:45958513-45958535 TTGAGGAGGAACCATGCTGGTGG - Intergenic
1190310803 X:49115860-49115882 GGGAGGGGGACTCAGGCTGCAGG + Intronic
1190945451 X:55089064-55089086 GTGAGAAAGAATCAAGATGGCGG - Exonic
1195045297 X:101049997-101050019 GTCAGGAGGAAGGAAACTGCAGG + Intronic
1196193753 X:112819302-112819324 GTGAGGATCAATCAAGTTCCAGG - Intronic
1197057238 X:122135653-122135675 CTGTGGAAAAATCAAGCTGCAGG - Intergenic
1199472191 X:148207439-148207461 GAGAGGAGAAATCAAACTGCTGG + Intergenic
1200425087 Y:3011624-3011646 GTGAGGAAGAAACAAGATGAAGG - Intergenic
1201975720 Y:19846953-19846975 GTGAAAAAAAATCAAGCTGCAGG + Intergenic