ID: 966908120

View in Genome Browser
Species Human (GRCh38)
Location 3:184542468-184542490
Sequence TAGGGTAGGGCAGCCTGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 203}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966908120 Original CRISPR TAGGGTAGGGCAGCCTGAGC AGG Intronic
900174509 1:1285866-1285888 CAGGGTAGGGAGGCCTGAGTGGG + Intronic
900542769 1:3212379-3212401 GGGGGCAGGGCTGCCTGAGCGGG + Intronic
901377159 1:8847761-8847783 TGGGGAAGGGCAGCCCGAGGCGG - Intergenic
901495367 1:9618115-9618137 TAGGGTGGGCCAGACTGTGCTGG + Intergenic
902202534 1:14844729-14844751 GTTGGTAGGGCAGCCTGAGAAGG + Intronic
902217161 1:14941523-14941545 TAGGCCAGGGCAGCCTGGGTTGG + Intronic
902716884 1:18279175-18279197 CAGGGGAGGGCAGCCTCAGAAGG - Intronic
902992569 1:20199466-20199488 CAGGGTAGTGTAGCCTGAACAGG - Intergenic
905102066 1:35532679-35532701 CAGGGTATGGCAGCGTGGGCAGG - Intronic
905446340 1:38030540-38030562 TAGGGGAGGGCTGCCCCAGCAGG - Intergenic
905857525 1:41323823-41323845 TGGGGTAGGGCAGCGGGCGCTGG - Intergenic
905888120 1:41502633-41502655 TAGGATGGGCCAGCCTGAGATGG - Intergenic
905919591 1:41710635-41710657 TAGGGCAGGGAAGCCTGGGCGGG - Intronic
905995870 1:42380510-42380532 TGGGGTGGGACAGCCGGAGCAGG - Intergenic
906299299 1:44670528-44670550 TAGAGTAGAGCAGCCCAAGCTGG - Intronic
912941518 1:114049300-114049322 CAGGGTAATGGAGCCTGAGCAGG - Intergenic
915790310 1:158662682-158662704 TTGGTTAGTACAGCCTGAGCAGG - Exonic
915972770 1:160366199-160366221 GAGGGCAGGGCAGCCTAGGCAGG - Intergenic
915979916 1:160413947-160413969 TAGGGTAGGGAAGACTGGGGAGG - Intronic
918577461 1:186079936-186079958 TAGGGTGTGGCAGCTGGAGCAGG + Intronic
919754878 1:201060586-201060608 TTGGGTAGGGCAGGATGAGTAGG - Intronic
919793632 1:201308196-201308218 CAGGGTGAGGCAGCCTGTGCCGG - Intronic
920223884 1:204424213-204424235 TTGGGGAGGGCTGCCTGTGCTGG - Exonic
920512255 1:206559884-206559906 GAGGGTGAGGCAGGCTGAGCTGG + Intronic
922703987 1:227779338-227779360 TGGGGTTGGGCAGCCAGGGCAGG - Intronic
923463315 1:234226322-234226344 TAGGGTAAGGGACCCAGAGCGGG - Intronic
924775537 1:247112574-247112596 TCGAGTAGGGCATCCAGAGCTGG - Intergenic
1065206778 10:23364456-23364478 CAGGGAAGGGCAGACTGAGAGGG - Intergenic
1066492114 10:35903854-35903876 TATGATGGGGCAGCATGAGCTGG - Intergenic
1069309478 10:67016526-67016548 TAGGGAAGGGAAGCCTCAGAGGG - Intronic
1069688696 10:70335461-70335483 TGGGCCAGGGCAGCCGGAGCTGG - Intronic
1069800834 10:71080565-71080587 TCGGGGAGGCCAGCCTGGGCTGG - Intergenic
1071137687 10:82470847-82470869 TAGGGCAGGGGAGCTTGAGGAGG - Intronic
1072050601 10:91699559-91699581 TTTGTTATGGCAGCCTGAGCAGG + Intergenic
1074045796 10:109838039-109838061 TAGGGTAGGGGGCTCTGAGCTGG + Intergenic
1077394924 11:2316049-2316071 TAGGGAAAGGCAGCACGAGCAGG - Intronic
1079036594 11:17025651-17025673 TAGAAAAGGGCTGCCTGAGCCGG + Intergenic
1083325145 11:61869358-61869380 TAGGGTTGGGAGGCCTGGGCTGG - Intergenic
1083652243 11:64210473-64210495 AAGAGTGGGGCAGCCTGGGCGGG - Intronic
1084119792 11:67062420-67062442 TGAGGGAGGGCACCCTGAGCAGG + Intronic
1084813102 11:71627638-71627660 AAGGGAAGGGCAGAGTGAGCAGG - Intergenic
1088796589 11:113270708-113270730 TGGGGTAGGGCAGCATTAGAGGG + Intronic
1089255202 11:117190429-117190451 CAGGGTGGGGCAGGCTGGGCTGG - Intronic
1091556528 12:1577654-1577676 GAGGGCAGGGCAGGGTGAGCAGG + Intronic
1091793197 12:3283223-3283245 TGGGGTAGGGCAGGCTGTGGGGG - Exonic
1093588724 12:20873374-20873396 TAGGTTAGTGCAGAGTGAGCAGG - Intronic
1096626782 12:52900693-52900715 GAGGAGAGGGGAGCCTGAGCTGG + Intronic
1096636076 12:52960487-52960509 TTAAGTAGGGCAGCCTGGGCAGG + Intergenic
1096857835 12:54497936-54497958 TAGGGCAGGGAACCCTGAGGCGG + Intronic
1097827007 12:64184499-64184521 TAGGGGAGGGCAGCAGTAGCAGG - Intergenic
1100642564 12:96496336-96496358 TTTGTTATGGCAGCCTGAGCTGG - Intronic
1107211394 13:37859894-37859916 TGGGGGTGGGGAGCCTGAGCTGG - Intronic
1107249492 13:38341344-38341366 TAGGGCAGGGCAGACTGTTCAGG + Intergenic
1115639705 14:35326342-35326364 TAGGCTTGCACAGCCTGAGCAGG - Intergenic
1118028271 14:61793330-61793352 GAGGGGAGGATAGCCTGAGCCGG - Intronic
1119888561 14:78165000-78165022 TAGGTAAGAGCAGCCTGGGCTGG - Intergenic
1121678082 14:95770640-95770662 TTTGTTATGGCAGCCTGAGCTGG + Intergenic
1125334907 15:38617465-38617487 TTGGCTAGGGCAACCTGGGCAGG - Intergenic
1126498973 15:49323367-49323389 TAAGACTGGGCAGCCTGAGCAGG + Intronic
1127377055 15:58394592-58394614 TGGCGTAGGGCAGCATGAGATGG - Intronic
1127483730 15:59400449-59400471 TGGGGTAGGGGGGTCTGAGCCGG - Intronic
1128316519 15:66662729-66662751 TTGGGCAGGGCCGCCTGAGGAGG - Intronic
1128551987 15:68603841-68603863 TCTGTTATGGCAGCCTGAGCAGG + Intronic
1129032613 15:72629686-72629708 GTGGGTAGGGCAGGCAGAGCTGG + Intergenic
1129217279 15:74107558-74107580 GTGGGTAGGGCAGGCAGAGCTGG - Intronic
1129470568 15:75751298-75751320 GTGGGTAGGGCAGGCAGAGCTGG + Intergenic
1131677251 15:94683059-94683081 TGGCGTAGGGAAGCCTGAGGGGG - Intergenic
1132271510 15:100530482-100530504 GAGGCTAGGGAAGCTTGAGCAGG - Intronic
1132851847 16:2028355-2028377 GAGGGTAGGGCTGCCAGGGCTGG + Intronic
1132862411 16:2078151-2078173 TGGGGTGGGGCAGCCTGGGAGGG + Intronic
1136585836 16:31184100-31184122 TGGGGTAGGGGAGCCTGTGTTGG + Intronic
1137322811 16:47402539-47402561 CTGGGTCGGGCAGCCAGAGCCGG - Intronic
1137770069 16:51009058-51009080 TAGGGTAGGGGAGTCGGAGCTGG - Intergenic
1138051306 16:53781539-53781561 TGGGGTTGGGCTGCCTGAGGAGG + Intronic
1138541084 16:57688284-57688306 GAGAGTGGGGCAGCCTGGGCTGG - Intronic
1141784089 16:86186941-86186963 TACGGCAGGGCAGCCTGGCCAGG + Intergenic
1142782035 17:2188767-2188789 TCAGGAAGGGCAGTCTGAGCTGG + Intronic
1143573467 17:7775982-7776004 TAGGGCAGCTCAGCCTGAGGGGG - Intronic
1144308966 17:13994928-13994950 TAGGGTTAAGTAGCCTGAGCTGG + Intergenic
1144798773 17:17911316-17911338 TAGGGTAGGCCAGGCTGGGCTGG - Intronic
1147917725 17:43898605-43898627 TAGGTAATGCCAGCCTGAGCAGG + Intronic
1150455247 17:65302080-65302102 TTTGTTATGGCAGCCTGAGCAGG - Intergenic
1151946550 17:77322991-77323013 AGCTGTAGGGCAGCCTGAGCTGG - Intronic
1152506851 17:80755076-80755098 AGGGGCAGGGCAGCCTGAGGGGG + Intronic
1156644219 18:39140547-39140569 TACAGTAGGTCAGCATGAGCAGG + Intergenic
1156661468 18:39351115-39351137 AAGGGGAGGGCAGCCTCAGGAGG - Intergenic
1156763025 18:40616325-40616347 AAGGGAAGGGAAGCATGAGCAGG - Intergenic
1160123203 18:76148413-76148435 TGGGGGAGGGCAGACTGAGTTGG - Intergenic
1160814588 19:1029165-1029187 TTGGGTAGGGTCCCCTGAGCTGG - Intronic
1162058071 19:8077114-8077136 TTTGTTATGGCAGCCTGAGCTGG + Intronic
1162528781 19:11223261-11223283 GAGGGGAAGGCAGCCTGAGGAGG - Intronic
1162777695 19:12989919-12989941 TGGGGTAGGGCAGCCAGAGTTGG + Intergenic
1164160239 19:22621448-22621470 TAGGGTAGCGCTGCCACAGCTGG + Intergenic
1167510052 19:49891075-49891097 TCGGGGAGGGGAACCTGAGCCGG - Exonic
1167765846 19:51481730-51481752 TATGTTAGGACAGGCTGAGCTGG + Intronic
1168622360 19:57889450-57889472 TAGGGTTAGGGAGCCTGAGGAGG + Intronic
927884429 2:26709901-26709923 CAGGGTAAGGCAGGCGGAGCTGG - Intronic
927979962 2:27368937-27368959 TACTATTGGGCAGCCTGAGCTGG + Intronic
928023338 2:27720924-27720946 TTGGGAAGGGCAGGCTGGGCAGG + Intergenic
928373926 2:30760030-30760052 TAGGGTAGGGCAGACAGGGGTGG - Intronic
929574307 2:43042360-43042382 TGGGGTAGGGCAGTCAGGGCAGG + Intergenic
930592927 2:53351022-53351044 TGGGGTAGGGCAGGGTAAGCAGG - Intergenic
931166977 2:59758825-59758847 TAGTCTAGGGCAGCCTGAAGAGG - Intergenic
931275448 2:60740096-60740118 TGAGGCAGGACAGCCTGAGCTGG - Intergenic
932020273 2:68077621-68077643 TCTGTTATGGCAGCCTGAGCAGG - Intronic
935184772 2:100722130-100722152 TAGGGTAGGGCAGCCCTGCCTGG + Intergenic
935360305 2:102241052-102241074 TAGGTTGCGGCAGCCTGAACGGG - Intergenic
935392055 2:102563161-102563183 TAGGGTAGGGCAGGCAGAAATGG - Intergenic
937929904 2:127195938-127195960 TAGATTAGGGCAGCCAGAGTGGG - Intronic
947704717 2:232264912-232264934 TGGGCTCGGGCAGCCTGAGCAGG + Intronic
947718144 2:232352052-232352074 GAGGGTCGGGGAGACTGAGCCGG - Intergenic
1169260816 20:4136678-4136700 TCCAGTAGGGCAGCCTGACCTGG - Intronic
1169815495 20:9651764-9651786 TGGGGTGGGGCAGGCAGAGCAGG + Intronic
1175263226 20:57687800-57687822 TTGAGAAGGGCAGGCTGAGCAGG - Intronic
1176041875 20:63069956-63069978 CAGGGCGGGGCGGCCTGAGCTGG + Intergenic
1176289539 21:5036864-5036886 TAGGGCAGGGTCCCCTGAGCAGG - Intronic
1178727782 21:35070240-35070262 TAGCCTAGGACAGCCTCAGCTGG + Intronic
1178762324 21:35414990-35415012 CAGGGTAGGTCAGCATGAGCTGG + Intronic
1179867691 21:44226723-44226745 TAGGGCAGGGTCCCCTGAGCAGG + Intronic
1179985219 21:44917065-44917087 AAGGGTGTGGCACCCTGAGCAGG + Intronic
1180137166 21:45869351-45869373 CAGGGTGGGGCAGCCTGATGGGG - Intronic
1180195739 21:46192413-46192435 TAGGGCAGGTCTGCTTGAGCAGG - Intronic
1180741415 22:18055629-18055651 TAGGGCAGGCCTGTCTGAGCAGG - Intergenic
1180848445 22:18997463-18997485 CAGGGCAGGGATGCCTGAGCAGG - Intergenic
1181630517 22:24148775-24148797 CAGGGGGGTGCAGCCTGAGCGGG - Intronic
1181688059 22:24542929-24542951 TGGGCCAGGGCATCCTGAGCGGG + Exonic
1183689746 22:39381980-39382002 CTGGGCAGGGCAGCCTGGGCAGG - Exonic
1184108328 22:42381451-42381473 GAGGGCAGGGCAGGCTGGGCCGG + Exonic
1185080070 22:48704775-48704797 TTTGCTACGGCAGCCTGAGCCGG - Intronic
952436564 3:33277591-33277613 TAGGGTCGGGCAGGCGGCGCAGG + Intronic
954130143 3:48556612-48556634 GTGGGTAGGGCGGCCTGGGCGGG - Intronic
960994008 3:123329328-123329350 GAGGGAAGGGGAGCCTGGGCAGG + Intronic
961596444 3:128021904-128021926 CAGGGCAGGGCAGGCTGTGCTGG - Intergenic
963746725 3:149131604-149131626 GGGCCTAGGGCAGCCTGAGCAGG - Intronic
966301660 3:178485786-178485808 TTTGTTAGGGCAGCCGGAGCAGG + Intronic
966851985 3:184170276-184170298 CGGGGTGGGGCAGGCTGAGCGGG - Intronic
966908120 3:184542468-184542490 TAGGGTAGGGCAGCCTGAGCAGG + Intronic
966947129 3:184784624-184784646 TAGGAGGGGGCAGCCTGAGTAGG + Intergenic
967378135 3:188828288-188828310 CAGAGTTAGGCAGCCTGAGCTGG + Intronic
969409132 4:7016384-7016406 CACGGTGGGGCAGCCTGTGCAGG - Intronic
971255646 4:25011179-25011201 TAGGGGAGGGGAGGATGAGCTGG - Intronic
976708773 4:88046385-88046407 AAGTGTAGGGAAGACTGAGCAGG + Intronic
980560398 4:134465423-134465445 TTTGTTATGGCAGCCTGAGCTGG - Intergenic
981581866 4:146257507-146257529 TAGGGTAGTTCAGCCAGTGCTGG - Intronic
982565398 4:156979680-156979702 TGGAGTAGGGCATCCTGATCAGG - Intergenic
983149538 4:164261158-164261180 TAGGGCTGGGCTGCCTGAGAAGG - Intronic
983287448 4:165757621-165757643 AAAGGTAGAGAAGCCTGAGCTGG - Intergenic
983693162 4:170497293-170497315 GAGGGTAGGGAAGCTGGAGCGGG - Intergenic
986241142 5:5961074-5961096 TAGAGCTGGGCAGCCTCAGCAGG - Intergenic
987179829 5:15355998-15356020 TAGGGTAGGTCATTCAGAGCAGG + Intergenic
987708687 5:21483999-21484021 CAGGGCAGGGATGCCTGAGCAGG - Intergenic
988750922 5:34190146-34190168 CAGGGCAGGGATGCCTGAGCAGG + Intergenic
991815518 5:70508186-70508208 CAGGGCAGGGATGCCTGAGCAGG + Intergenic
992177673 5:74166441-74166463 TAGGATAGGGCTGGGTGAGCAGG + Intergenic
995215797 5:109592918-109592940 TAGGGTATGGAAGTTTGAGCTGG + Intergenic
997229792 5:132234089-132234111 TGGGGCAGGGCAGGCTGAGTAGG - Intronic
997367245 5:133333894-133333916 TTGGGAAGGGCAGAGTGAGCTGG + Intronic
998065540 5:139155255-139155277 TTTGTTAGAGCAGCCTGAGCAGG - Intronic
998137991 5:139684527-139684549 TGGGCCAGGGCAGCCTGAACAGG + Intergenic
998212905 5:140214775-140214797 TAGAGTAGGGCAGTCTTAGAAGG + Intronic
998395413 5:141814825-141814847 CTGGGTAGGGCAGCCTGGGATGG - Intergenic
998402010 5:141853041-141853063 TGTGGGAGGCCAGCCTGAGCGGG + Intergenic
1000037757 5:157461589-157461611 TTGGGCAAGGAAGCCTGAGCTGG + Intronic
1000202718 5:159027408-159027430 TATGTTAGGGCAGCCTAACCTGG - Intronic
1000285563 5:159823488-159823510 TTTGTTATGGCAGCCTGAGCAGG - Intergenic
1001282738 5:170399011-170399033 CAGAGTAGGGCATCCTCAGCAGG + Intronic
1001721945 5:173864280-173864302 TAGGTTTGGGCTGGCTGAGCTGG - Intergenic
1002435819 5:179230173-179230195 GAGGGCAGGGCAGGCTGGGCAGG + Intronic
1002443313 5:179275338-179275360 TAGGGTAGAGCCGGCTGAGATGG + Intronic
1002534498 5:179868831-179868853 CAGGGCAGGGCAGGCTGAGGAGG + Intronic
1004344140 6:14832711-14832733 AATGGCAGGGCAGCCTGAGCAGG + Intergenic
1007839966 6:44708047-44708069 TTTGTTATGGCAGCCTGAGCTGG - Intergenic
1009019812 6:57937885-57937907 CAGGGCAGGGATGCCTGAGCAGG + Intergenic
1017258350 6:152359989-152360011 AAGAGGAGGGCAGCCTGGGCTGG - Intronic
1017343080 6:153348616-153348638 TTTGTTATGGCAGCCTGAGCAGG + Intergenic
1018338066 6:162817146-162817168 GAGGCTGGGGCAGCCTGTGCCGG - Intronic
1018847332 6:167564785-167564807 CATGGGAGGACAGCCTGAGCTGG + Intergenic
1019142574 6:169957532-169957554 AAGCGAAGGGCAGCCTGGGCTGG + Intergenic
1019706103 7:2497990-2498012 TAGGGAGGGGCAGCGTGTGCAGG + Intergenic
1024358921 7:48447316-48447338 TTGGGTAGGGCATCTTGAACTGG + Intronic
1024559536 7:50631695-50631717 TAGGGTAGGTCACCCAGAACAGG - Intronic
1025241612 7:57281260-57281282 TAGGCTAGGGCAGCCCCTGCTGG + Intergenic
1026769721 7:73187950-73187972 CAGGGCAGGGCGGCCTGCGCTGG + Intergenic
1027010589 7:74741332-74741354 CAGGGCAGGGCGGCCTGCGCTGG + Intronic
1027077453 7:75204708-75204730 CAGGGCAGGGCGGCCTGCGCTGG - Intergenic
1029436935 7:100568774-100568796 AGGGCCAGGGCAGCCTGAGCAGG - Intergenic
1031530393 7:122868345-122868367 TAGTGTAGGGCAGAATGAGTGGG + Intronic
1034225546 7:149477953-149477975 TAGGGTAGGAAAGGCTGAGGCGG + Intronic
1035174469 7:157040357-157040379 TTGGGTAAGGCAGCCTTGGCTGG - Intergenic
1035406759 7:158603947-158603969 GAGGAGAGGGCAGCCTGACCAGG - Intergenic
1035730943 8:1853242-1853264 CAGGGAAGGGCGGCCTGGGCAGG - Intronic
1035787511 8:2273278-2273300 TAAGCTAGTTCAGCCTGAGCTGG - Intergenic
1035805297 8:2448438-2448460 TAAGCTAGTTCAGCCTGAGCTGG + Intergenic
1037827410 8:22167614-22167636 TAGGGTGGGGCTGGCTGAGTTGG + Intronic
1041858099 8:62480921-62480943 TAGGAGAGGGCACCCTGACCGGG + Intronic
1042846250 8:73172273-73172295 TAGGGTAGGGGATGCTGAGTGGG - Intergenic
1046724144 8:117656031-117656053 TCTGTTACGGCAGCCTGAGCAGG - Intergenic
1049687907 8:143946331-143946353 CAAGGTAGGGCAGGCAGAGCTGG - Intronic
1049766215 8:144356451-144356473 TAGGCTAGGGAAGCCTGGTCCGG + Exonic
1050114090 9:2245049-2245071 TTAGTTATGGCAGCCTGAGCAGG + Intergenic
1052834436 9:33240178-33240200 TGGGATAGTGTAGCCTGAGCTGG - Exonic
1053227588 9:36374287-36374309 TTTGTTATGGCAGCCTGAGCGGG - Intronic
1056953197 9:91062165-91062187 TGGGGTAGGAGAGCCTCAGCTGG + Intergenic
1059459587 9:114421277-114421299 TAGGGGAGAGCCCCCTGAGCTGG + Intronic
1060050654 9:120376079-120376101 AAGGGTGGGGCAGCCTCAGAAGG - Intergenic
1060766506 9:126298164-126298186 TAGGGTAAGGCAGCCCCAGGTGG + Intergenic
1061675992 9:132215962-132215984 CAGGGAAGGGCAAGCTGAGCTGG - Intronic
1062409867 9:136418155-136418177 GAGGGCAGGGCTGGCTGAGCCGG - Intronic
1062501914 9:136855344-136855366 CAGGGTAGGGCAGAGTCAGCAGG - Intronic
1062502700 9:136858153-136858175 CAGGGCAGGGCAGCCTCAGCGGG - Intronic
1186819968 X:13277726-13277748 TAGGGTAGAGCAGTCTTAGGAGG + Intergenic
1198206131 X:134466613-134466635 TTTGTTATGGCAGCCTGAGCAGG + Intronic
1199722143 X:150549599-150549621 TAGGGGAGGGGAGCCTGAACTGG + Intergenic