ID: 966910519

View in Genome Browser
Species Human (GRCh38)
Location 3:184557127-184557149
Sequence CCCTCCAGGCCCCAGGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 718
Summary {0: 1, 1: 1, 2: 8, 3: 88, 4: 620}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966910519_966910533 8 Left 966910519 3:184557127-184557149 CCAGCTGCCTGGGGCCTGGAGGG 0: 1
1: 1
2: 8
3: 88
4: 620
Right 966910533 3:184557158-184557180 CGGCTCACCTCCTGGGGTTTGGG 0: 1
1: 0
2: 0
3: 10
4: 116
966910519_966910538 27 Left 966910519 3:184557127-184557149 CCAGCTGCCTGGGGCCTGGAGGG 0: 1
1: 1
2: 8
3: 88
4: 620
Right 966910538 3:184557177-184557199 TGGGAATGTGCCCGGGTGTAAGG 0: 1
1: 0
2: 0
3: 5
4: 104
966910519_966910532 7 Left 966910519 3:184557127-184557149 CCAGCTGCCTGGGGCCTGGAGGG 0: 1
1: 1
2: 8
3: 88
4: 620
Right 966910532 3:184557157-184557179 GCGGCTCACCTCCTGGGGTTTGG 0: 1
1: 0
2: 0
3: 23
4: 488
966910519_966910537 20 Left 966910519 3:184557127-184557149 CCAGCTGCCTGGGGCCTGGAGGG 0: 1
1: 1
2: 8
3: 88
4: 620
Right 966910537 3:184557170-184557192 TGGGGTTTGGGAATGTGCCCGGG 0: 1
1: 0
2: 3
3: 34
4: 324
966910519_966910530 2 Left 966910519 3:184557127-184557149 CCAGCTGCCTGGGGCCTGGAGGG 0: 1
1: 1
2: 8
3: 88
4: 620
Right 966910530 3:184557152-184557174 GCCAGGCGGCTCACCTCCTGGGG 0: 1
1: 0
2: 0
3: 11
4: 166
966910519_966910528 0 Left 966910519 3:184557127-184557149 CCAGCTGCCTGGGGCCTGGAGGG 0: 1
1: 1
2: 8
3: 88
4: 620
Right 966910528 3:184557150-184557172 GGGCCAGGCGGCTCACCTCCTGG 0: 1
1: 0
2: 0
3: 14
4: 227
966910519_966910529 1 Left 966910519 3:184557127-184557149 CCAGCTGCCTGGGGCCTGGAGGG 0: 1
1: 1
2: 8
3: 88
4: 620
Right 966910529 3:184557151-184557173 GGCCAGGCGGCTCACCTCCTGGG 0: 1
1: 0
2: 1
3: 16
4: 172
966910519_966910536 19 Left 966910519 3:184557127-184557149 CCAGCTGCCTGGGGCCTGGAGGG 0: 1
1: 1
2: 8
3: 88
4: 620
Right 966910536 3:184557169-184557191 CTGGGGTTTGGGAATGTGCCCGG 0: 1
1: 0
2: 2
3: 26
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966910519 Original CRISPR CCCTCCAGGCCCCAGGCAGC TGG (reversed) Intronic