ID: 966910754

View in Genome Browser
Species Human (GRCh38)
Location 3:184558577-184558599
Sequence GCCTTGGGCAATAAGCAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966910754 Original CRISPR GCCTTGGGCAATAAGCAATG AGG (reversed) Intronic
903656541 1:24952229-24952251 ACCATGGGCTATAAGCACTGTGG - Intronic
906201089 1:43960855-43960877 GCCTTGGGAAGAAAGCAAAGGGG - Exonic
912226853 1:107743573-107743595 GCCCTGGGCAAATAACAATGAGG - Intronic
914708928 1:150195261-150195283 ACCTTGATGAATAAGCAATGAGG + Intergenic
919474291 1:198015824-198015846 CCTTTTGGAAATAAGCAATGTGG - Intergenic
919991820 1:202712602-202712624 GCCTGGGGGAATAAGCAAGAGGG - Intergenic
922347359 1:224707531-224707553 GGCTTGGCCAATGAGCAATGTGG + Intronic
1069266947 10:66471102-66471124 ACCATGGACAATAAACAATGGGG - Intronic
1069420858 10:68245170-68245192 GCCTTGGGCAATAAATTACGGGG - Intergenic
1074500291 10:114017650-114017672 GCCATGGGCAAGAAGCAACAGGG + Intergenic
1078965383 11:16334370-16334392 CCCTTGGGCAAGAAGGAATCAGG - Intronic
1081952553 11:47057536-47057558 ACATTGGGCAATAGGCAGTGGGG + Intronic
1083659624 11:64246123-64246145 GCCTTGGGCAAGAGGCAAGGGGG - Intronic
1089868494 11:121652150-121652172 GACTTGGGCCATGAGGAATGAGG + Intergenic
1094316724 12:29144368-29144390 GTCTTGGGCTATAGGCAATCTGG - Intergenic
1097045330 12:56183663-56183685 GCCTTGGGCTAAAAGGATTGAGG - Intronic
1099242241 12:80152130-80152152 TCCTAGGGCAAGAAGGAATGGGG + Intergenic
1099459146 12:82901683-82901705 GTATTGGGTAATAAGAAATGAGG + Intronic
1099978507 12:89571405-89571427 GCCGTGGAGAATAAACAATGAGG - Intergenic
1104366599 12:128183637-128183659 GCCTTGGACAATGAGCATTGAGG + Intergenic
1106117816 13:26832202-26832224 GGCTTGGGCCACAAGCTATGTGG - Intergenic
1110096965 13:71538152-71538174 GCCTTGAGAAATAATCAATGTGG - Intronic
1110569723 13:76991103-76991125 GCCTATGGGAATAAGCAAGGTGG - Exonic
1111691845 13:91573727-91573749 GTCTTGGACACTAAGCAATATGG + Intronic
1115053387 14:29092337-29092359 GCCTTGGGGAATAATAAATTAGG - Intergenic
1115298689 14:31859226-31859248 ACCTTTGGAAATCAGCAATGTGG + Exonic
1116608496 14:47034664-47034686 TCCATGTGCAATAAGCAAAGTGG - Intronic
1117882672 14:60327768-60327790 GCCTTGGTCATTAAGCCACGAGG - Intergenic
1120255197 14:82109958-82109980 GTCTTGGGAAATAAGGAAAGGGG + Intergenic
1123012156 14:105354681-105354703 GCCTGAGGCAATCAGCAAGGTGG - Intronic
1123471142 15:20553136-20553158 GCTTTGGGCAAAAAGCAATATGG + Intergenic
1123646916 15:22447563-22447585 GCTTTGGGCAAAAAGCAATATGG - Intergenic
1123731443 15:23148130-23148152 GCTTTGGGCAAAAAGCAATATGG + Intergenic
1123749581 15:23345542-23345564 GCTTTGGGCAAAAAGCAATATGG + Intergenic
1124281954 15:28369417-28369439 GCTTTGGGCAAAAAGCAATATGG + Intergenic
1124300749 15:28542183-28542205 GCTTTGGGCAAAAAGCAATATGG - Intergenic
1127298534 15:57630832-57630854 GCTTTGAGCAATAAACTATGTGG - Intronic
1127816184 15:62611071-62611093 GCCGTGGGCAAGAAGCAAGAGGG + Intronic
1134142450 16:11732837-11732859 TTCTTGGGCCATAATCAATGGGG - Intronic
1137013427 16:35347153-35347175 GCTGTGGGCAACAAGCAAGGGGG - Intergenic
1141521487 16:84583092-84583114 GCCTTGGGAAATGTGCAGTGTGG + Intronic
1141904798 16:87017345-87017367 GCTTTGGGAAATAAGCTCTGGGG - Intergenic
1143217170 17:5233718-5233740 GTCTTGGCCATGAAGCAATGTGG - Intronic
1144592642 17:16537385-16537407 GCCTTGGACAGTAAGCAAATAGG + Intergenic
1145837023 17:27962138-27962160 GGCTTTGGCTATAAGGAATGGGG - Intergenic
1150008652 17:61485754-61485776 GCTTTGGGGAAGGAGCAATGAGG - Intergenic
1150990001 17:70246266-70246288 ACCTTGGGCAATCATGAATGTGG - Intergenic
1151409124 17:73909544-73909566 TCCCTGCGCAATAAGCAATTGGG + Intergenic
1157819154 18:50752778-50752800 GACATGGACAATAAGAAATGAGG + Intergenic
1158236732 18:55323681-55323703 GCCTTGTGTATTAAGCAGTGAGG - Intronic
1160178685 18:76616206-76616228 CCCTTTGGAAATTAGCAATGAGG - Intergenic
1162273250 19:9633325-9633347 GCCTGGGGTAATAAGTCATGCGG + Intronic
1163211762 19:15845989-15846011 GCCTTGGGCAGCAAGGAGTGGGG + Intergenic
1163241366 19:16065867-16065889 GCCTTGGGCAGAAAACAAGGAGG + Intergenic
1163875665 19:19865764-19865786 GCCTTAGGCATTATCCAATGAGG + Intergenic
1164601288 19:29565314-29565336 GTCTTGGACTAGAAGCAATGCGG - Intergenic
1166071452 19:40390323-40390345 GCCTTGGGCATACAGGAATGGGG + Intergenic
1166408225 19:42539071-42539093 GCCTTGGGCAAGACCCAGTGCGG - Intronic
925735292 2:6958480-6958502 ACCTTGAGCAATAACCCATGTGG + Intronic
930230586 2:48840521-48840543 GCCTTGGGCAGTACCTAATGCGG - Intergenic
931210022 2:60184011-60184033 GTATTGGGTAATAAGAAATGAGG - Intergenic
932073086 2:68640390-68640412 GTCTTGGGGAAGAAGGAATGGGG - Intergenic
932746733 2:74340027-74340049 GCCTGGGGCAGTGAGAAATGGGG + Intronic
937717080 2:125044802-125044824 TCCTTGGGGAATAAGCACAGTGG - Intergenic
939190222 2:138908520-138908542 GCCTTGGGCACTAGGCAAGAAGG - Intergenic
941342889 2:164329279-164329301 GGCTGGGGCACTCAGCAATGAGG + Intergenic
941525038 2:166596876-166596898 GCCTTAAGCAATAAGCAAATGGG + Intergenic
943411213 2:187550868-187550890 GCCTTGGGAAATGAGGAATGAGG + Intronic
946254738 2:218434314-218434336 GCTTTAGGCTAGAAGCAATGGGG + Intronic
946352029 2:219161401-219161423 GCTTTATGCAAGAAGCAATGAGG - Intronic
946946973 2:224831460-224831482 GCCTTGGGCGAGAAGAAAAGGGG - Intronic
947614332 2:231545455-231545477 GCCTTGGGCAGTCAGCCAGGGGG - Intergenic
1169268118 20:4180059-4180081 CCCTTGGGCGATAAGCAACCTGG - Intronic
1170070253 20:12358501-12358523 ACCTTGGGTAAAAGGCAATGTGG + Intergenic
1171129436 20:22636147-22636169 TCCTTGGGCAAAGAGGAATGAGG + Intergenic
1173223140 20:41145747-41145769 GTTTTGGGGAAGAAGCAATGGGG + Intronic
1173662101 20:44741928-44741950 GCCCTGGGGAATAGGCAGTGTGG + Intergenic
1177305565 21:19310902-19310924 GCCATGGGGAATAAGCACTCAGG - Intergenic
1178598596 21:33976623-33976645 GGCTGGGGCAACAAGCACTGGGG - Intergenic
1180030253 21:45201955-45201977 GCTTTGGGCAAGCAGCAAGGAGG + Intronic
952527198 3:34223125-34223147 GCCTTGAGCAACAAGAAATTTGG + Intergenic
953304488 3:41814742-41814764 GCTTTGGGCAAAAAGCAATATGG - Intronic
953760406 3:45682462-45682484 GCCTTGGGCATTGGGCCATGTGG + Exonic
957153936 3:76522337-76522359 GAGTTGGGAAATAAGCAGTGGGG - Intronic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
961339905 3:126211182-126211204 GCCACGGGCAATGAGCAGTGTGG - Intergenic
963046362 3:141105358-141105380 GCCATGGGCAGTAAGAAATGGGG - Intronic
966198660 3:177339004-177339026 GGCTTGGGCAATAAGGAAACTGG + Intergenic
966901858 3:184492469-184492491 GCCTTGGGCAGTGAGGAAGGGGG + Intronic
966910754 3:184558577-184558599 GCCTTGGGCAATAAGCAATGAGG - Intronic
967441793 3:189517277-189517299 GGCATGGGCAAGAAGCTATGGGG - Intergenic
969136032 4:5029535-5029557 ACCTAGGGCTGTAAGCAATGGGG + Intergenic
972589858 4:40474724-40474746 ACCTTTGGCAAAAAGCAATCAGG + Intronic
976870405 4:89786260-89786282 ACCATAGGCAATAAACAATGGGG - Intronic
979587410 4:122437409-122437431 GCCTGGGGAAATAAGGAATGGGG - Intergenic
981284821 4:143004382-143004404 GTCTTGGTCAATAAGCTATGTGG - Intergenic
983285513 4:165735087-165735109 TCCTTGGGCCAGAAACAATGAGG + Intergenic
984655502 4:182313195-182313217 GCCTTAGGCTATAAGAAAAGTGG - Intronic
986214088 5:5701940-5701962 GCCTTAGGCACTATGCATTGGGG - Intergenic
987669695 5:20990710-20990732 TCCCTGGGCAAGAAGCAAAGAGG - Intergenic
988442084 5:31244691-31244713 GCCTTGGGCTGTAAACAATAGGG + Intronic
989719254 5:44504834-44504856 GCCCTGGGTAATAAGCCCTGAGG - Intergenic
991190580 5:63868457-63868479 GCCTGGGACAATAAGTAAGGAGG - Intergenic
996052986 5:118952801-118952823 GTCTTGGAGCATAAGCAATGTGG - Intronic
997887148 5:137640046-137640068 ACCCTGGGCGATAAGCCATGTGG - Intronic
998383194 5:141740690-141740712 GCCCTGGGCAAAGAGCTATGAGG + Intergenic
998933149 5:147203854-147203876 GCCTTGGGCAGTGAACATTGTGG + Intergenic
999861887 5:155656987-155657009 GCCTTTTGAACTAAGCAATGGGG - Intergenic
1003342991 6:5239786-5239808 GCCTTGGGAAAAGACCAATGTGG - Intronic
1011114443 6:83874704-83874726 GCCTTGGGGAAGAAGCGATCAGG - Intronic
1011437143 6:87350694-87350716 CCCTTGGGAAGTAAGCTATGGGG - Intronic
1018994622 6:168701479-168701501 GCCTTGGGAAGTAAGCAGGGAGG + Intergenic
1021306066 7:19034079-19034101 GCCCAGGGCAAGAAGCGATGGGG + Intronic
1024137429 7:46424970-46424992 GCCTTGGACAAAAGGTAATGAGG - Intergenic
1033513960 7:142087718-142087740 GACTTGTGCAGTCAGCAATGCGG + Intronic
1035144672 7:156802375-156802397 GCATTGGGAAATAAAAAATGAGG - Intronic
1037483832 8:19329073-19329095 GCCATGGGCAATAGGAAATGAGG - Intronic
1041438910 8:57872987-57873009 GCCTTGTGCAATAATTTATGAGG + Intergenic
1044278516 8:90329652-90329674 TCATTGGGCAATTAGCAATGTGG + Intergenic
1046049883 8:109010248-109010270 TCCTTGGAAAATGAGCAATGAGG - Intergenic
1048410719 8:134169343-134169365 ACCTTGGGCTAGAGGCAATGCGG - Intergenic
1050875457 9:10629289-10629311 GCCGTGGGCAACAATCAATAAGG - Intergenic
1052198892 9:25753264-25753286 TCCTTGGGTAATATGCAAAGCGG - Intergenic
1056569363 9:87802351-87802373 CACCTGGGCATTAAGCAATGGGG + Intergenic
1056569494 9:87803087-87803109 GCCTTGGGCAAGAATACATGTGG - Intergenic
1186444104 X:9611524-9611546 GCATTGGGGAATCAGCACTGGGG - Intronic
1188346323 X:29070582-29070604 GGTTTGGGCAATGAACAATGTGG - Intronic
1189383451 X:40518163-40518185 ATCTTGGCCAATAAGCAGTGTGG + Intergenic
1190062959 X:47222675-47222697 GCCGTGGGCAAGAGGCAATAGGG + Intronic
1190110663 X:47587055-47587077 GCCCTGGGCAAATAGCAATTAGG - Intronic
1190792131 X:53710410-53710432 GCCATGGGCCATTAGAAATGTGG - Intergenic
1191253461 X:58269990-58270012 GCCTTGGGAAAAAAGCGACGAGG - Intergenic
1193695842 X:84707174-84707196 GCCTTGGGCAACACTGAATGTGG - Intergenic
1194485137 X:94477261-94477283 GACTTGAAAAATAAGCAATGGGG + Intergenic
1198178487 X:134180769-134180791 GCCTTTCGGAATGAGCAATGTGG + Intergenic
1198278444 X:135119038-135119060 GCCTTGGACAAAAAGTCATGTGG - Intergenic
1198292518 X:135253478-135253500 GCCTTGGACAAAAAGTCATGTGG + Intronic
1198298424 X:135309681-135309703 GCCTTGGACAAAAAGTCATGTGG + Intronic
1200905351 Y:8476301-8476323 GACTTGTGCAAAAATCAATGTGG - Intergenic