ID: 966911691

View in Genome Browser
Species Human (GRCh38)
Location 3:184563288-184563310
Sequence TCGGAGCCATTAAATGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 84}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966911683_966911691 28 Left 966911683 3:184563237-184563259 CCACAAACAATAGGGAGGCCCAC 0: 1
1: 0
2: 1
3: 9
4: 87
Right 966911691 3:184563288-184563310 TCGGAGCCATTAAATGAGAGAGG 0: 1
1: 0
2: 1
3: 5
4: 84
966911687_966911691 -6 Left 966911687 3:184563271-184563293 CCCCGTTTCCAAGAATTTCGGAG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 966911691 3:184563288-184563310 TCGGAGCCATTAAATGAGAGAGG 0: 1
1: 0
2: 1
3: 5
4: 84
966911689_966911691 -8 Left 966911689 3:184563273-184563295 CCGTTTCCAAGAATTTCGGAGCC 0: 1
1: 0
2: 0
3: 7
4: 99
Right 966911691 3:184563288-184563310 TCGGAGCCATTAAATGAGAGAGG 0: 1
1: 0
2: 1
3: 5
4: 84
966911688_966911691 -7 Left 966911688 3:184563272-184563294 CCCGTTTCCAAGAATTTCGGAGC 0: 1
1: 0
2: 0
3: 2
4: 72
Right 966911691 3:184563288-184563310 TCGGAGCCATTAAATGAGAGAGG 0: 1
1: 0
2: 1
3: 5
4: 84
966911684_966911691 10 Left 966911684 3:184563255-184563277 CCCACACACACTCACGCCCCGTT 0: 1
1: 0
2: 1
3: 13
4: 169
Right 966911691 3:184563288-184563310 TCGGAGCCATTAAATGAGAGAGG 0: 1
1: 0
2: 1
3: 5
4: 84
966911685_966911691 9 Left 966911685 3:184563256-184563278 CCACACACACTCACGCCCCGTTT 0: 1
1: 0
2: 0
3: 10
4: 139
Right 966911691 3:184563288-184563310 TCGGAGCCATTAAATGAGAGAGG 0: 1
1: 0
2: 1
3: 5
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966911691 Original CRISPR TCGGAGCCATTAAATGAGAG AGG Intronic
900976399 1:6019496-6019518 TCAGCACCATTAAAAGAGAGTGG + Intronic
908991526 1:70096828-70096850 TCTGGGCCATAAAATGAGAATGG + Intronic
909117747 1:71560724-71560746 TAAAAGCCATTAAATGAGAAAGG + Intronic
916215219 1:162387968-162387990 CCGAAGCCATTCAATGGGAGAGG - Intergenic
917699681 1:177567796-177567818 CCTGAGCCATTTATTGAGAGGGG - Intergenic
918205323 1:182303224-182303246 TTGGTGCCATTAATTGAGACAGG + Intergenic
918525930 1:185464976-185464998 TGGGAGCCATAAAATCAGATAGG + Intergenic
919746444 1:201011940-201011962 TCAGAGCCCTTCAATGAGAGGGG + Intronic
923922844 1:238588255-238588277 AGGAAGCCATCAAATGAGAGGGG - Intergenic
1063580295 10:7300404-7300426 TCAGCCCCATGAAATGAGAGTGG - Intronic
1067700779 10:48570286-48570308 TTGGAGTCATAAAAAGAGAGAGG - Intronic
1069298255 10:66874111-66874133 TCACAGTCATTCAATGAGAGGGG + Intronic
1069319611 10:67152209-67152231 TGGGAGCCATTAGACAAGAGAGG - Intronic
1070776675 10:79113793-79113815 TAGGAGCCATCAATGGAGAGGGG - Intronic
1071600784 10:86957848-86957870 TGGGAGCCATGAAAAGAGCGTGG + Exonic
1078064597 11:8069818-8069840 TCAGAGCCATGAATTAAGAGTGG - Intronic
1080559996 11:33454298-33454320 TCAGAGGCAACAAATGAGAGGGG + Intergenic
1095253627 12:40007805-40007827 TAGAAGCCATTAAATATGAGTGG + Intronic
1096191988 12:49625313-49625335 TCCAAGACATTAAATGGGAGAGG - Intronic
1098199451 12:68039338-68039360 TAGGAGGCAATAAATGAGGGAGG - Intergenic
1100876622 12:98968654-98968676 TAGGAGCCATTAAATGACAGAGG + Intronic
1109069103 13:57740142-57740164 TTGGAGCCACTGAATGACAGAGG - Intergenic
1116040489 14:39680412-39680434 TCAGAGCCATTAAATGAACTTGG - Intergenic
1118205948 14:63723792-63723814 TCTGACCCATTAGATGAGTGAGG - Intronic
1118333033 14:64828464-64828486 TGGGAACCATTAAAGGAGAGGGG + Intronic
1122103183 14:99429991-99430013 CCCCAGCCATTAAACGAGAGGGG + Intronic
1124445326 15:29725869-29725891 TCAGAGCCTTTAAATGCCAGTGG + Intronic
1129891745 15:79076265-79076287 TCAGATCCATTAAAACAGAGTGG + Intronic
1133775240 16:8890242-8890264 TCGCAGCCTTTAACTGAGTGAGG - Intergenic
1133907138 16:10032720-10032742 TCTGAGCCATTAAACAACAGTGG + Intronic
1141306885 16:82873185-82873207 TCAAAGCCCTAAAATGAGAGTGG + Intronic
1143462875 17:7115025-7115047 TCGGAGGCAGGAAGTGAGAGGGG - Intronic
1150558564 17:66275600-66275622 TCTTAGCTATGAAATGAGAGTGG - Intergenic
1150645949 17:66977594-66977616 TCAGAACGATTAAATGAGATTGG + Intronic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1166623455 19:44327284-44327306 ACAGAGACATTTAATGAGAGGGG - Exonic
925875922 2:8311170-8311192 TCCTAGCCAGTAAGTGAGAGAGG + Intergenic
933215010 2:79619704-79619726 TCTGAGCCATTTAATATGAGTGG - Intronic
933812289 2:86040317-86040339 AAGGGGCCATTTAATGAGAGGGG - Intronic
939263008 2:139834261-139834283 TTGGTGCCATTACATGAGATGGG + Intergenic
940190533 2:151036106-151036128 TAGGAGAGATTAACTGAGAGTGG + Intronic
1169548482 20:6675944-6675966 ACGCAGCCATTAAATGAGTCCGG + Intergenic
1171036309 20:21715027-21715049 TCGGAGCAAGGAAAAGAGAGTGG - Exonic
1174059637 20:47823603-47823625 TGGGAGTAATTTAATGAGAGAGG - Intergenic
1174778420 20:53366619-53366641 CTGTAGACATTAAATGAGAGAGG + Intronic
1179067119 21:38035733-38035755 TCAGAACCATTAAATGAGCTTGG - Intronic
1182043335 22:27255301-27255323 TTGGAGCCATTCAATTAGATAGG + Intergenic
1182869724 22:33635386-33635408 TCAGAGCCAGTGAATGAGACAGG - Intronic
1185362948 22:50420069-50420091 TGGGAGCAATTAAAGGGGAGGGG - Intronic
956346794 3:68288115-68288137 TCTCAGCCATGAAAAGAGAGGGG - Intronic
957415974 3:79905373-79905395 CAGGAGCCTGTAAATGAGAGGGG - Intergenic
961468949 3:127099456-127099478 TCGGAGCCACCAAAGGACAGGGG + Intergenic
962029486 3:131584254-131584276 TAGGAGCCATCAACTAAGAGAGG - Intronic
966911691 3:184563288-184563310 TCGGAGCCATTAAATGAGAGAGG + Intronic
969562620 4:7959333-7959355 TCCGAGCAATTAAACGGGAGAGG - Intergenic
972092012 4:35298401-35298423 TCGGAGTCATTAGATCAGAAAGG + Intergenic
975900786 4:79149560-79149582 TCAGAGCCAAAAAATAAGAGAGG - Intergenic
976600859 4:86935933-86935955 CCGGAGCCAGCGAATGAGAGGGG + Intronic
982294221 4:153809959-153809981 TAGAAGTCATTAAATGAGAAGGG - Intergenic
991237186 5:64412309-64412331 TCAGAGCCATTTAATGAGCCAGG + Intergenic
994682176 5:102901974-102901996 ACTGAGCCTTTAAATCAGAGAGG + Intronic
995833374 5:116377530-116377552 TCCGCGCCATCAAATGAGAAGGG + Intronic
999111783 5:149127707-149127729 TCTGACCCAGTAAATGAGATAGG + Intergenic
1001935396 5:175699954-175699976 TCAGAGCCATGAGATGAGATGGG - Intergenic
1005411203 6:25548759-25548781 TCAGGGCCATTAAATGAGGATGG + Intronic
1008826576 6:55701788-55701810 TTTGAGCCAGCAAATGAGAGAGG - Intergenic
1010083901 6:71893328-71893350 TACGAGCTATTTAATGAGAGGGG - Intronic
1014290082 6:119548165-119548187 TTGGAGCCACTAAACCAGAGAGG - Intergenic
1015642888 6:135355976-135355998 TTGCAGCCATTAAATGGGTGAGG - Intronic
1019559840 7:1650584-1650606 TCAGAGGCAGTAAATGACAGTGG - Intergenic
1021474097 7:21041373-21041395 TCGTAAGCATTAAATGTGAGTGG + Intergenic
1021903321 7:25309553-25309575 TCTCAGCCATTCAATGTGAGGGG - Intergenic
1021934528 7:25616661-25616683 TCAGAGCCATGAATTTAGAGAGG + Intergenic
1023258413 7:38334941-38334963 TCGGTGGCAACAAATGAGAGGGG + Intergenic
1024130759 7:46350459-46350481 TTGGAGCCAGTAGAGGAGAGTGG - Intergenic
1030312163 7:108079779-108079801 TCCGAGCCCTAAAATGGGAGAGG + Exonic
1037547387 8:19938113-19938135 TCTCAGCCATAAACTGAGAGGGG + Intronic
1045745350 8:105412782-105412804 ACAGAGCCATTTAATGAGAAGGG - Intronic
1045761593 8:105614818-105614840 TCACAGCAATTAAATGAGAGGGG + Intronic
1046655377 8:116888238-116888260 AAGGAGCCATCAAATCAGAGTGG + Intergenic
1053460296 9:38263577-38263599 AAGGAGACATTAAATCAGAGTGG + Intergenic
1056032540 9:82567913-82567935 TTGCAGCTATTAACTGAGAGTGG + Intergenic
1058211808 9:102178016-102178038 GCGGAGCCATTAAGTGAGGGTGG + Intergenic
1059054096 9:110960674-110960696 TCTGAGCCATTAAGAGAGAGAGG + Intronic
1188191013 X:27171880-27171902 TGGGAACTATTAAATGAGTGTGG + Intergenic
1188402978 X:29770611-29770633 TCAGAGCTAATAAATGACAGAGG + Intronic
1190568689 X:51759675-51759697 TTGGAGGCATTAGATGAGTGTGG - Intergenic
1190763345 X:53454772-53454794 TGGGAACCATTAGATGGGAGAGG - Intergenic
1198714948 X:139548200-139548222 TTGGAGCCTTGAAATAAGAGTGG - Intronic
1200389485 X:155929844-155929866 TTGGTGCCATTAAGTGAGGGTGG - Intronic
1201362445 Y:13167724-13167746 TGTAAGCCCTTAAATGAGAGAGG - Intergenic