ID: 966912259

View in Genome Browser
Species Human (GRCh38)
Location 3:184566152-184566174
Sequence GATGCTGGCCACACTGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 235}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966912259_966912268 2 Left 966912259 3:184566152-184566174 CCAGACCCAGTGTGGCCAGCATC 0: 1
1: 0
2: 2
3: 13
4: 235
Right 966912268 3:184566177-184566199 AAGGAAGGGCTGAAGGGCTCAGG 0: 1
1: 0
2: 0
3: 45
4: 350
966912259_966912269 8 Left 966912259 3:184566152-184566174 CCAGACCCAGTGTGGCCAGCATC 0: 1
1: 0
2: 2
3: 13
4: 235
Right 966912269 3:184566183-184566205 GGGCTGAAGGGCTCAGGTTAAGG 0: 1
1: 0
2: 2
3: 12
4: 204
966912259_966912266 -5 Left 966912259 3:184566152-184566174 CCAGACCCAGTGTGGCCAGCATC 0: 1
1: 0
2: 2
3: 13
4: 235
Right 966912266 3:184566170-184566192 GCATCACAAGGAAGGGCTGAAGG 0: 1
1: 0
2: 2
3: 21
4: 204
966912259_966912267 -4 Left 966912259 3:184566152-184566174 CCAGACCCAGTGTGGCCAGCATC 0: 1
1: 0
2: 2
3: 13
4: 235
Right 966912267 3:184566171-184566193 CATCACAAGGAAGGGCTGAAGGG 0: 1
1: 0
2: 0
3: 19
4: 170
966912259_966912270 9 Left 966912259 3:184566152-184566174 CCAGACCCAGTGTGGCCAGCATC 0: 1
1: 0
2: 2
3: 13
4: 235
Right 966912270 3:184566184-184566206 GGCTGAAGGGCTCAGGTTAAGGG 0: 1
1: 0
2: 1
3: 11
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966912259 Original CRISPR GATGCTGGCCACACTGGGTC TGG (reversed) Intronic
901060879 1:6471398-6471420 GATGCTGGGCAGACCGGATCGGG + Intronic
902606121 1:17570290-17570312 GAGGATGGGGACACTGGGTCAGG + Intronic
904034515 1:27551588-27551610 GCTGTTGGCCAAACTGGGTGAGG + Exonic
904346679 1:29876945-29876967 GATGCTGGCTGCCCTGGGTGCGG + Intergenic
904435249 1:30490724-30490746 GATGCTCCCCACAGAGGGTCAGG - Intergenic
906940837 1:50253679-50253701 GGTGCTGGTCAAACTGGGGCAGG + Intergenic
910999212 1:93144794-93144816 GAAGCTGGGCACAGTGGCTCAGG - Intergenic
912826775 1:112911652-112911674 CATGCTGGGCACAGTGGCTCAGG - Intergenic
913393454 1:118340228-118340250 GATGCTGCCCACAGTGAGCCTGG + Intergenic
913598312 1:120398475-120398497 GATGCTGGTCAAACAGGATCTGG + Intergenic
914309593 1:146453371-146453393 GATGCTGGTCAAACAGGATCTGG + Intergenic
914512098 1:148343211-148343233 GATGCTGGTCAAACAGGATCTGG - Intergenic
914592517 1:149119768-149119790 GATGCTGGTCAAACAGGATCTGG - Intergenic
917966528 1:180182551-180182573 GGTGCAGGCGACACTGGGTGCGG - Intronic
920374419 1:205499849-205499871 GCTGCAGGCCACACTGGCTGGGG - Intergenic
921162461 1:212482945-212482967 GAGCCTGGCCACGCTTGGTCAGG + Intergenic
922170836 1:223153142-223153164 GTGCCTGGCCACACTGGGTGAGG + Intergenic
1062911881 10:1216833-1216855 GATGCTGGGCACATGCGGTCAGG - Intronic
1064039015 10:11941701-11941723 GATGCAGGCCCCACTGGGGTGGG - Intronic
1064463434 10:15556484-15556506 CAGGCTGGGAACACTGGGTCTGG - Intronic
1065837201 10:29669408-29669430 AGTGCTGGCCACACAGGCTCTGG + Intronic
1067658197 10:48213063-48213085 GAATCTGGCCTCACTGGGGCTGG + Intronic
1069186369 10:65428793-65428815 GAGGGTTGCCACACTGGCTCAGG + Intergenic
1070665118 10:78337247-78337269 GATGCTGGCCTCAGAGGGACGGG + Intergenic
1072698429 10:97621660-97621682 CATGCTGGCCATTCTGGTTCAGG - Intronic
1073212229 10:101814125-101814147 CATGTTGGCCAGGCTGGGTCTGG - Intronic
1075967168 10:126623064-126623086 GCTGCTGGCCAGGCAGGGTCGGG - Intronic
1077030235 11:462215-462237 GCTCCTGGCCCCTCTGGGTCTGG - Intronic
1078548531 11:12264037-12264059 GATGCTGGGCATAGTGGGTGAGG + Intergenic
1079106247 11:17574187-17574209 GATGCTGGCCACACAAGGAGAGG + Intronic
1080577085 11:33609697-33609719 CCTGCCGGCCCCACTGGGTCAGG + Intronic
1081864992 11:46354475-46354497 GAGGCTGGGCACAGTGGCTCAGG - Intronic
1083203337 11:61132883-61132905 GGTGCTGTCCACTCTGTGTCTGG - Intronic
1084063693 11:66691463-66691485 GCTGCTGGACACACGGGGTCAGG - Exonic
1084281769 11:68100847-68100869 GATGCGTGCACCACTGGGTCTGG - Intronic
1084428502 11:69098494-69098516 CATGTTGGCCAGGCTGGGTCAGG + Intergenic
1084537405 11:69765158-69765180 GAGGCTGGACACAGTGGCTCAGG - Intergenic
1084593661 11:70104816-70104838 AGTGCTGGCCTCACAGGGTCGGG + Intronic
1084645525 11:70455161-70455183 GAGGCTGGGCACAGTGGCTCAGG - Intergenic
1085299413 11:75449657-75449679 GAGGCTGGTGACACAGGGTCTGG - Intronic
1085673614 11:78493384-78493406 GAGGCTGGGCACAGTGGCTCAGG + Intronic
1086952782 11:92908158-92908180 TATGCTGGACACACTTGTTCTGG + Intergenic
1089290579 11:117435701-117435723 CATCCTGGCCACACTGGGGGTGG - Exonic
1090219653 11:125007911-125007933 GGTGCTGGCAACAGTGGGTGTGG + Intronic
1091756193 12:3053677-3053699 GAAGCTGGGCACAGTGGCTCAGG - Intergenic
1092034518 12:5320279-5320301 AATGCTGGCCTCACTGAGTTTGG - Intergenic
1092218929 12:6700197-6700219 GATGGGGGCCACGCTGGGGCTGG - Exonic
1096378333 12:51133505-51133527 GATGCTGCCCAGACTGAGACTGG + Intronic
1096564798 12:52469495-52469517 GAGGCTGCCCACACTGGTCCAGG - Intronic
1096584179 12:52608843-52608865 AATGCTGGCCCCACAGGGTTTGG - Intronic
1100550390 12:95641550-95641572 GATGCTGGCCACCCTAGGATGGG - Intergenic
1102470548 12:113157631-113157653 CATGCTGGCCGGCCTGGGTCAGG + Exonic
1102971952 12:117175597-117175619 GCTGGTGGCAACACTGGGACTGG - Intronic
1103620866 12:122186367-122186389 CATGCTGGCCACACTATGTGGGG - Intronic
1105781555 13:23709228-23709250 AATCCTGGGCACACTGGGGCAGG + Intergenic
1107443018 13:40445406-40445428 GGTGATGCCCACACTGGGCCAGG - Intergenic
1112175543 13:97019970-97019992 GATGATGGCCAAGCTGGGGCAGG - Intergenic
1112428440 13:99326735-99326757 GGTGCTGGACTCACTGGGCCTGG - Intronic
1113932336 13:113974968-113974990 GACGCTGGTCACACTGGGTCAGG + Intergenic
1116016927 14:39418342-39418364 GAGGCTGGGCACAGTGGCTCCGG - Intronic
1118447056 14:65861678-65861700 GATGATGGCCACACAGGTTTTGG + Intergenic
1118447151 14:65862328-65862350 GATGATGGCCACACAGGTTTTGG - Intergenic
1122856156 14:104561147-104561169 GATGCTGGCCAGACATGGTGGGG - Intronic
1124013339 15:25857160-25857182 TAGGCTGGGCACACTGGCTCAGG + Intronic
1124106632 15:26744039-26744061 GATGTTGGTCACACTGGGAGGGG - Intronic
1126166881 15:45660998-45661020 GTTGCTGGGCACAGTGGCTCAGG + Intronic
1128740187 15:70078594-70078616 GATGCTGCCCATGCTGGGGCAGG - Intronic
1128792752 15:70445100-70445122 GATGCTGGCCATCCTGGAGCTGG - Intergenic
1129387360 15:75203126-75203148 GATGCTGGCCACAATTGGGCAGG + Intronic
1130310314 15:82747519-82747541 TAGGCCGGCCACAGTGGGTCAGG + Intergenic
1132496559 16:266195-266217 TTTGCTGGCCAGCCTGGGTCAGG + Intronic
1132930866 16:2458671-2458693 AATTCTGGCCACCCTGGGTGGGG + Exonic
1133251098 16:4481763-4481785 GATGATGGCTACACTTGGACAGG - Intronic
1133789780 16:9000635-9000657 GAGGCTGGGCACAGTGGTTCAGG - Intergenic
1134177071 16:12015816-12015838 GAGGCTGGGCACAGTGGCTCAGG - Intronic
1134494840 16:14724704-14724726 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134500223 16:14763824-14763846 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134511560 16:14852487-14852509 GTTGCTGGCTACAATGTGTCTGG + Exonic
1134526765 16:14950436-14950458 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134545641 16:15105912-15105934 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134580356 16:15365226-15365248 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134699202 16:16250985-16251007 GTTGCTGGCTACAATGTGTCTGG + Exonic
1134714342 16:16348913-16348935 GATGGGGGCCCCACTGGGTGGGG - Intergenic
1134722217 16:16392277-16392299 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134945210 16:18319592-18319614 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134952474 16:18359745-18359767 GATGGGGGCCCCACTGGGTGGGG + Intergenic
1134972630 16:18543690-18543712 GTTGCTGGCTACAATGTGTCTGG - Exonic
1135587611 16:23682820-23682842 GATGCAGGCCAGGCTGGGTATGG - Intronic
1135689750 16:24526709-24526731 GCTGCTGGGCACAGTGGCTCAGG + Intergenic
1138112133 16:54332120-54332142 GAAGCTGGGCACAGTGGTTCGGG - Intergenic
1138595698 16:58027842-58027864 GAGGGTGGCCAGACTGGGTCGGG - Intronic
1141827051 16:86487943-86487965 GATGCTGGCAACCCTGGGAGTGG - Intergenic
1141886965 16:86898885-86898907 GAAGCTGGCCTCACTGTTTCTGG - Intergenic
1142978816 17:3659992-3660014 GCTGCTGGCCACCCTGCGGCTGG + Intronic
1143565721 17:7719417-7719439 GATGATGGCCAGGCTGGGTGCGG - Intronic
1144122758 17:12172320-12172342 GAGGCTTAACACACTGGGTCGGG - Intergenic
1144451483 17:15383498-15383520 GATGCCAACCTCACTGGGTCAGG - Intergenic
1144549876 17:16230769-16230791 GAGGCTGGCCACGGTGGCTCAGG - Intronic
1147174012 17:38640570-38640592 GAGGCTGGGCACAGTGGCTCAGG + Intergenic
1147669076 17:42166291-42166313 GGTGCTGGCCATCCTGGGTAAGG - Exonic
1149531795 17:57401718-57401740 TTTGCTGGCCACACGGGGCCTGG + Intronic
1149603865 17:57911223-57911245 GATGCTGGCACCACTGGTCCAGG + Intronic
1150389546 17:64782237-64782259 GAATCTGGCCACACTCGTTCTGG + Intergenic
1150789899 17:68195665-68195687 GAATCTGGCCACACTCGTTCTGG - Intergenic
1151238133 17:72736502-72736524 GATGGAGGCCACATGGGGTCCGG - Intronic
1151827166 17:76529937-76529959 GCTGCTGACCACACTGGCCCCGG - Intronic
1152387302 17:79982423-79982445 GAAGCTGGGCACAGTGGCTCAGG - Intronic
1153827539 18:8889842-8889864 GATTCTGTCTACACTGGATCTGG + Intergenic
1157614206 18:48977184-48977206 AGTGCTGGGCACACTGGGCCTGG - Intergenic
1158175522 18:54651698-54651720 GAGGCTGGGCACAGTGGCTCAGG - Intergenic
1158721962 18:59933022-59933044 GAGGCTGGCCCCACTGGGGATGG - Intergenic
1159820930 18:73142803-73142825 CATGCTGGTCACATTGGCTCAGG - Intergenic
1160354632 18:78216536-78216558 GATCCTGTCCCCACTGGGCCAGG + Intergenic
1161589620 19:5123444-5123466 GACACTGGCCACGCTGGGCCTGG + Intronic
1162345759 19:10117129-10117151 GGTGGTGGCCACATTGGGTCCGG + Exonic
1164845636 19:31430328-31430350 GCTGCTGGTCACTCTGGCTCAGG - Intergenic
1166214980 19:41328936-41328958 GCTGTTGGCAGCACTGGGTCTGG - Intronic
1166688065 19:44808051-44808073 GTCGCTGGCCACACTGGGAGAGG - Intergenic
1167252138 19:48405052-48405074 GAGGCTGGCCTCACTGGATCTGG + Exonic
1168127770 19:54296153-54296175 GACGCTGGGCACAGAGGGTCAGG - Intergenic
1168172694 19:54599313-54599335 GACGCTGGGCACAGAGGGTCAGG + Intronic
925785996 2:7431671-7431693 GAACCTGGACACACTGGGTGGGG + Intergenic
927507379 2:23623236-23623258 GATGCTGGGCACCATGAGTCGGG - Intronic
927743333 2:25591378-25591400 GATGCTGGCTGCACTGGGGGAGG - Intronic
927798811 2:26077696-26077718 GAGGCTGGGCACAGTGGCTCAGG + Intronic
927879909 2:26682989-26683011 GGTGCTGGCAACACTGGGCCTGG - Intergenic
929277701 2:40043583-40043605 GATGCTGGACATACTGAGGCAGG + Intergenic
932872736 2:75419667-75419689 CATGCTGGGCACACTTGATCTGG + Intergenic
935689560 2:105718549-105718571 GATGGGGGACACACTGGTTCTGG + Intergenic
936847506 2:116854417-116854439 GATGCTGGCCAGTGTGAGTCTGG - Intergenic
939561031 2:143731975-143731997 GAAGCTGGCCACAGGGGCTCTGG - Intronic
940050416 2:149456588-149456610 GATGCTTGTCAGACTGGATCAGG - Intronic
940430904 2:153588561-153588583 GATGCAGGGCACCCTGAGTCTGG + Intergenic
943210706 2:184962092-184962114 CATGCTGTCCAGACTGGTTCCGG - Intergenic
943442488 2:187943091-187943113 GATGCTGGCTACCCTGGGAAGGG + Intergenic
943752571 2:191525209-191525231 TATTCTGGCCAGACTGGGTATGG + Intergenic
945204356 2:207316206-207316228 GATGCTGGGGACACTGGTGCTGG - Intergenic
946157638 2:217817739-217817761 GGTGCTGCCCCCACTGGGACTGG + Exonic
947524785 2:230871456-230871478 GCTGCTGGCCACAGGGGGTTGGG - Intronic
948902366 2:240963112-240963134 GCTGCTGCCCACACTAGGACAGG + Intronic
1170382618 20:15777844-15777866 CATGCTGGCCAGGCTGGTTCTGG + Intronic
1170780311 20:19419760-19419782 GATGGAGGCCACACGGGCTCAGG + Intronic
1170786734 20:19473716-19473738 AATGCTGTCCACAGAGGGTCTGG + Intronic
1172267608 20:33630227-33630249 GAGGCTGGGCACAGTGGCTCAGG - Intronic
1173834908 20:46118673-46118695 GAGGCTGGCCACACAGAGACTGG + Intronic
1174768743 20:53277992-53278014 TGTGCTGGCCAAACTGGGACAGG - Intronic
1175710823 20:61219364-61219386 GAAGCTGGCCAGCCTGGCTCAGG - Intergenic
1175948016 20:62567733-62567755 GGTGCTGGGCACACAGGGCCGGG + Intronic
1176235245 20:64050769-64050791 GCTTCTGGCCACACAGGCTCAGG - Intronic
1179584193 21:42364690-42364712 CAGTCTGGCCACACTGGCTCAGG + Intronic
1179626021 21:42650135-42650157 GAGGCTGGCCACCCTGGGTGGGG - Intergenic
1179942472 21:44649028-44649050 GATGCGGGACCCACTGAGTCAGG + Intronic
1180025372 21:45158158-45158180 GAAGCTGGCCAGACAGGGCCAGG - Intronic
1180727495 22:17957283-17957305 GCAGCTGGCTACACTGGCTCTGG + Intronic
1180960328 22:19759519-19759541 GATGCTGAACGCACTGGCTCGGG - Intronic
1181133762 22:20750190-20750212 GATACTGGCCAGATTGGATCAGG - Intronic
1181829222 22:25546088-25546110 GCTGCTGGCCCCTCTGTGTCTGG + Intergenic
1181875974 22:25941189-25941211 GATCCAGCCCACACTAGGTCGGG + Intronic
1182526767 22:30925471-30925493 GATGCAGGCCACACTGGAATGGG - Intronic
1183028562 22:35084795-35084817 GATGTTGGACACACGGGCTCTGG + Intronic
1183297433 22:37038894-37038916 CAGGCTGGGCACACTGGCTCAGG + Intergenic
1183659151 22:39208197-39208219 GAGGCTGGCCAGACTGCGGCAGG - Intergenic
1184821058 22:46909587-46909609 GAAGCTGGCCACACAGAGTTAGG - Intronic
1185367555 22:50443850-50443872 CATGTTTGCCACACAGGGTCGGG + Exonic
950082989 3:10236627-10236649 GAGGCTGGGCACAGTGGCTCAGG - Intronic
950499742 3:13356039-13356061 GAGATTGGCCACACTGAGTCAGG - Intronic
953904071 3:46859469-46859491 CGTGCTGGCCACGCTGGGTGAGG - Exonic
953956293 3:47234532-47234554 AATGCTGGGCACAGTGGCTCTGG - Intronic
954441779 3:50526103-50526125 TATGCTGCCCACAATGGGTGGGG - Intergenic
955213812 3:56966730-56966752 GAGACAGGCCACACAGGGTCTGG - Intronic
956857172 3:73286679-73286701 GATGCTGGACTCACAGGGTCTGG - Intergenic
957335110 3:78818230-78818252 GATGCTGGACAGGCTGGGCCAGG - Intronic
959886213 3:111504093-111504115 GTTGCTGGGCACAGTGGCTCAGG + Intronic
961268940 3:125672778-125672800 GTTGCTGGTCTCACTGGCTCAGG - Intergenic
961380862 3:126495852-126495874 CATGGTGGCCACACTGGGAGGGG - Intronic
961919628 3:130412390-130412412 GCTGCTAACCACACTGGGTGAGG + Intronic
963716955 3:148813674-148813696 CATTCTGGCCACACAGGGTCAGG - Intronic
966912259 3:184566152-184566174 GATGCTGGCCACACTGGGTCTGG - Intronic
969202702 4:5618406-5618428 GCTGCTGGCCCTACAGGGTCTGG - Intronic
969327264 4:6451234-6451256 GATCCAGCCCACACTGTGTCAGG - Intronic
969556708 4:7916518-7916540 GATGCTGGTTTCGCTGGGTCAGG - Intronic
969664333 4:8548435-8548457 GATGCCGCCCACACTGGGGAGGG - Intergenic
972181748 4:36475363-36475385 GTTGCTGGGCACAGTGGCTCAGG + Intergenic
978446889 4:108788619-108788641 GTTGCTGGGCACAGTGGCTCAGG - Intergenic
979368043 4:119848465-119848487 GATGCAGGGCACCCTGGGCCTGG + Intergenic
981179028 4:141716805-141716827 CATCCTGGGCACACTGGGTGGGG - Intronic
985587924 5:750556-750578 GATGCTGGCATCACGGGATCTGG + Intronic
985602593 5:843023-843045 GATGCTGGCATCACGGGATCTGG + Intronic
985725576 5:1514214-1514236 GATGCTGGGCACAAGGGGCCCGG + Intronic
986672653 5:10156830-10156852 CATTCTGGGCACACTGGGACAGG + Intergenic
987322488 5:16783643-16783665 CCTGCTGGCCACATTGTGTCTGG + Intronic
987782283 5:22454754-22454776 GAGGCTGGGCACAGTGGCTCAGG - Intronic
988208143 5:28166911-28166933 GTTGCTGGCCACACTGGATTAGG - Intergenic
988614637 5:32763593-32763615 GAGGCTGGGCACAATGGCTCAGG - Intronic
992179351 5:74181704-74181726 GATGCTGGTCACACTGAATTAGG - Intergenic
993020905 5:82589575-82589597 GACTCTGGCCACATTGTGTCTGG + Intergenic
997377130 5:133405309-133405331 GATGCTGCACACACTGCCTCTGG - Intronic
997974933 5:138435799-138435821 AATACTGACCACACTGGCTCTGG - Exonic
998374235 5:141680780-141680802 GTTCCTGCCCACCCTGGGTCTGG + Intronic
999753820 5:154649515-154649537 GGTGTTGGCCACACAGGGTGGGG - Intergenic
1000262413 5:159600464-159600486 CATCCTGGCCACTCTGGCTCTGG - Intergenic
1001023565 5:168204505-168204527 GCTGCTGGCCCCAGTGGCTCTGG + Exonic
1001865878 5:175105015-175105037 GATTCTGGCCAAACTGGGAAAGG + Intergenic
1002450816 5:179317569-179317591 GCTGCTGGCCACCCATGGTCTGG - Intronic
1003343293 6:5242436-5242458 GAGGCTGGGCACAGTGGCTCAGG + Intronic
1005893665 6:30160579-30160601 GCTGGTGTCCACACTGGGTTTGG - Exonic
1006284495 6:33082111-33082133 GAAGGTGGACACACTGGGTGGGG + Intronic
1006614584 6:35317843-35317865 CAGGCTGGCCTCACTGGGTCAGG - Intronic
1007097093 6:39220101-39220123 CTTGTTGGCCACACTGGGTGGGG - Intronic
1012356038 6:98315754-98315776 GCTGCTAGCCACAGAGGGTCTGG + Intergenic
1014928379 6:127302679-127302701 AAGGCTGGGCACAGTGGGTCAGG - Intronic
1015906510 6:138123022-138123044 GATGCTGGCCTCAATGAGTTGGG - Intergenic
1015906742 6:138124929-138124951 GATGCTGGCCTCAATGAGTTGGG - Intergenic
1019735534 7:2648229-2648251 GATGCTGGCCACAGGGGCACAGG - Intronic
1021885883 7:25138511-25138533 GTTGCTGGGCACAGTGGCTCAGG - Intronic
1023378762 7:39585340-39585362 GATACTGGTCAGACTGGGTTAGG - Intronic
1024903716 7:54352219-54352241 GGTGGTGGGCACACTGGGTGGGG + Intergenic
1026928513 7:74210143-74210165 GCTCCTGGCCCCACTGGGTGGGG + Intronic
1029952691 7:104603832-104603854 CATGCTGGGCACACTGGGGTGGG + Intronic
1030158772 7:106485610-106485632 GATGCAGGCCACCCTGGGAAAGG + Intergenic
1030159410 7:106491996-106492018 GATGCAGGCCACCCTGGGAAAGG + Intergenic
1032646102 7:133825613-133825635 GCTGCTGGCCACACTTCCTCGGG - Intronic
1035107066 7:156450092-156450114 GATGCTGTTAACACTGGGTAAGG - Intergenic
1035698677 8:1621328-1621350 GAGGTTGTCCACACTGGGTTGGG + Intronic
1039912307 8:41834967-41834989 GATGATGTCCATTCTGGGTCAGG - Intronic
1042169203 8:65975876-65975898 GATTCTGGACACACTGGGACAGG - Intergenic
1047464364 8:125098329-125098351 GATGCTGGTGACACTTGGTCAGG + Intronic
1049454971 8:142682148-142682170 GCTGCAGCCCACACTGGGTGTGG + Exonic
1049680245 8:143914938-143914960 GGTGGTGGCCACACTGAGGCCGG - Intergenic
1051440161 9:17074951-17074973 CAGGCTGGCCACAGTGGCTCAGG + Intergenic
1053243841 9:36518471-36518493 TATGTTGGCCACACTGGGTCTGG + Intergenic
1058151696 9:101470583-101470605 GATTCTGGATACACTGGGGCTGG + Intergenic
1060754866 9:126205559-126205581 CATGCTGGCCACACTCGATGAGG - Intergenic
1061094597 9:128448220-128448242 GAGGCTGGGCACAGTGGCTCAGG - Intergenic
1185470031 X:376656-376678 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470047 X:376717-376739 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470139 X:377075-377097 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470169 X:377193-377215 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470229 X:377429-377451 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470259 X:377547-377569 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470304 X:377726-377748 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470320 X:377787-377809 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470351 X:377909-377931 CATGGTGGCCCCACTGGGTGTGG - Intronic
1187842658 X:23504962-23504984 GGTGCAGGCTACAGTGGGTCAGG + Intergenic
1187845733 X:23534784-23534806 TATGCTGGGCACAGTGGCTCAGG + Intergenic
1193300095 X:79879335-79879357 GATGGTGGACACAGTGGTTCTGG + Intergenic
1195849468 X:109267481-109267503 GATTCTGGTGACACTGGGTTTGG - Intergenic
1197342081 X:125287003-125287025 GATGCTGGCTACAGTGGGGGAGG + Intergenic
1197635693 X:128912611-128912633 AGTACTGGTCACACTGGGTCTGG + Intergenic
1202377431 Y:24250305-24250327 CAGGCTGGCCACATTGGGTGAGG + Intergenic
1202493349 Y:25419816-25419838 CAGGCTGGCCACATTGGGTGAGG - Intergenic