ID: 966912679

View in Genome Browser
Species Human (GRCh38)
Location 3:184568353-184568375
Sequence CCGTCCTGCCATGTATCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 84}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966912679_966912689 7 Left 966912679 3:184568353-184568375 CCTGCAGATACATGGCAGGACGG 0: 1
1: 0
2: 1
3: 7
4: 84
Right 966912689 3:184568383-184568405 TGGGGTGCAGCAGGCAGCTGGGG 0: 1
1: 0
2: 6
3: 60
4: 546
966912679_966912687 5 Left 966912679 3:184568353-184568375 CCTGCAGATACATGGCAGGACGG 0: 1
1: 0
2: 1
3: 7
4: 84
Right 966912687 3:184568381-184568403 GATGGGGTGCAGCAGGCAGCTGG 0: 1
1: 0
2: 2
3: 42
4: 473
966912679_966912688 6 Left 966912679 3:184568353-184568375 CCTGCAGATACATGGCAGGACGG 0: 1
1: 0
2: 1
3: 7
4: 84
Right 966912688 3:184568382-184568404 ATGGGGTGCAGCAGGCAGCTGGG 0: 1
1: 0
2: 4
3: 32
4: 300
966912679_966912686 -2 Left 966912679 3:184568353-184568375 CCTGCAGATACATGGCAGGACGG 0: 1
1: 0
2: 1
3: 7
4: 84
Right 966912686 3:184568374-184568396 GGCGAGGGATGGGGTGCAGCAGG 0: 1
1: 0
2: 1
3: 61
4: 529
966912679_966912690 8 Left 966912679 3:184568353-184568375 CCTGCAGATACATGGCAGGACGG 0: 1
1: 0
2: 1
3: 7
4: 84
Right 966912690 3:184568384-184568406 GGGGTGCAGCAGGCAGCTGGGGG 0: 1
1: 0
2: 4
3: 66
4: 656

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966912679 Original CRISPR CCGTCCTGCCATGTATCTGC AGG (reversed) Intronic
909288704 1:73854696-73854718 CTGTCTTGTCCTGTATCTGCAGG - Intergenic
911068979 1:93817161-93817183 GCTTCCTGTCATGTTTCTGCAGG + Intronic
916795727 1:168165419-168165441 CCTTCCTTCCAAATATCTGCTGG + Intergenic
918971498 1:191425819-191425841 CAGGCTTCCCATGTATCTGCTGG + Intergenic
1064248002 10:13684539-13684561 CTGTCCTTCCATGTGTCTGCCGG - Intronic
1069080109 10:64079570-64079592 CCCTCCGGCCATGTATATGTGGG - Intergenic
1069729947 10:70603989-70604011 AAGTCCTGCAAAGTATCTGCGGG + Intergenic
1070441221 10:76445446-76445468 CCGTGATGCCCTGCATCTGCAGG - Intronic
1076463810 10:130664755-130664777 CAGTCCTGACAGTTATCTGCAGG - Intergenic
1077113431 11:872085-872107 CCTCCCTGCCATGTGTTTGCCGG - Intronic
1080631841 11:34084557-34084579 AAGTTGTGCCATGTATCTGCGGG + Intronic
1083381125 11:62269510-62269532 CAGTCCTGCCATGTCCTTGCTGG - Intergenic
1087077831 11:94142089-94142111 CCTTCCTGTCGTGTGTCTGCGGG + Intronic
1088746219 11:112807130-112807152 CCCTCCTGCCTTGTCCCTGCTGG - Intergenic
1090077152 11:123586749-123586771 CCTTCCTGCCTTGCCTCTGCTGG + Intronic
1090230177 11:125096907-125096929 TTGTCTTGCCATGTATCTGTAGG - Exonic
1091620958 12:2088685-2088707 ACCTCCTCCCATGTATCTGAAGG + Intronic
1102008977 12:109606611-109606633 CCGGCCTCCCCTTTATCTGCTGG - Intergenic
1113785630 13:113000829-113000851 CCGGCCTGCTATGTCCCTGCTGG - Intronic
1115876229 14:37864982-37865004 CCGTCCTACCCTGTCCCTGCAGG - Intronic
1118045211 14:61962348-61962370 CTGTCCTGCAAGGTTTCTGCTGG + Intergenic
1121269684 14:92629805-92629827 CTGCCCTGCCATTTATCAGCTGG - Intronic
1122154250 14:99740920-99740942 CCGTCCTGGCCAGAATCTGCAGG + Intronic
1128743103 15:70096786-70096808 CCTCCCTGCCATGTATCCGCAGG - Exonic
1129256714 15:74337936-74337958 CCTTCCTCCCATGTGGCTGCAGG + Exonic
1130154512 15:81337992-81338014 CATTCCTGCCAACTATCTGCAGG - Intronic
1132654089 16:1034612-1034634 CCGTCCTTCCATCTATCTATTGG + Intergenic
1134503847 16:14789804-14789826 CCGTCCTGCCAGGTTGGTGCAGG + Intronic
1134576725 16:15339095-15339117 CCGTCCTGCCAGGTTGGTGCAGG - Intergenic
1134725717 16:16417394-16417416 CCGTCCTGCCAGGTTGGTGCAGG + Intergenic
1134941717 16:18294464-18294486 CCGTCCTGCCAGGTTGGTGCAGG - Intergenic
1139254606 16:65528975-65528997 CCTTCCTGCCATGTGGCTGTAGG - Intergenic
1142157651 16:88539948-88539970 CTGGCCTGCCCTGTATCTGCCGG + Intergenic
1143694984 17:8607635-8607657 CCTTCCTACCATGTGTCTGGGGG - Intronic
1147202156 17:38809876-38809898 ACGTACTGCCAGGTAACTGCTGG - Intronic
1148150252 17:45392820-45392842 CCAACCTGCCATGTGGCTGCAGG + Intergenic
1156405023 18:36775377-36775399 CTGTCCTGCCAAGCATCGGCAGG + Intronic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1168267443 19:55230474-55230496 CCGTCCTCCCGTGGATCTCCCGG - Exonic
925608599 2:5684123-5684145 CCGTCCTGCCTTCTGGCTGCTGG - Intergenic
934937748 2:98477573-98477595 CTCTCCTGCCCTGTATCTCCAGG + Intronic
938064052 2:128271631-128271653 CTGTCCTGCCATGAAGCTGGAGG - Intronic
938169797 2:129064961-129064983 CCTTCCTGCCCTGTGTCTGCTGG + Intergenic
945064699 2:205938995-205939017 CCGACCTGCCATCTGTATGCTGG - Intergenic
946436266 2:219657793-219657815 CCATCCTGCCATCTCTATGCTGG - Intergenic
1174100650 20:48123963-48123985 CCGTGCTGCTATGTAACTGTGGG - Intergenic
1174671437 20:52311412-52311434 CCGCCCAGCCCTGCATCTGCAGG - Intergenic
1176290763 21:5043505-5043527 CCTTCCTGACATGGCTCTGCTGG - Intergenic
1178789830 21:35689502-35689524 CTTTCCTGCCAGGAATCTGCTGG + Intronic
1179492237 21:41748145-41748167 GCGTCCTGCCAGGCCTCTGCTGG - Intronic
1179866492 21:44220136-44220158 CCTTCCTGACATGGCTCTGCTGG + Intergenic
1181671012 22:24425362-24425384 CGCCCCTGCCATGGATCTGCCGG - Intronic
1185060867 22:48606079-48606101 CTGTCCTGCCACGTGACTGCTGG + Intronic
952923741 3:38306922-38306944 CCGCCCTAGCATGAATCTGCAGG + Intronic
954037171 3:47857367-47857389 TCGTCCTGCCATGGGTCAGCTGG - Intronic
959608764 3:108270770-108270792 CTTTCCTGACATGTGTCTGCAGG - Intergenic
962702243 3:138010789-138010811 CCCTGCTCCCATGTATGTGCAGG - Intronic
963954107 3:151234099-151234121 GCTTCCTGGCATGCATCTGCAGG - Intronic
966827901 3:183980462-183980484 CCATCCTGCCATCAACCTGCTGG + Intronic
966912679 3:184568353-184568375 CCGTCCTGCCATGTATCTGCAGG - Intronic
968205972 3:196800869-196800891 CACTCCTGCCCTGTATGTGCTGG - Intronic
976589078 4:86831187-86831209 CAGTCCTGCCCTTTGTCTGCTGG - Intronic
977923695 4:102673934-102673956 CGGTCCTGGAATGAATCTGCTGG + Exonic
977980599 4:103316629-103316651 CTGTCTTGCAATGTTTCTGCTGG + Intergenic
983573579 4:169236163-169236185 CAGTCCTGCCATGTGTCTAGAGG - Intronic
986466580 5:8032357-8032379 TCTTCCTGCCAAGTCTCTGCTGG + Intergenic
986597702 5:9440831-9440853 AATTTCTGCCATGTATCTGCAGG - Intronic
990530275 5:56666761-56666783 CCCTCCTTCCAATTATCTGCTGG + Intergenic
997112940 5:131095139-131095161 CCTGCCTGCCATGTAGCTGAGGG + Intergenic
998399573 5:141841593-141841615 CCCTGCTGCCCTGCATCTGCTGG + Intergenic
1002554062 5:180020485-180020507 ACCTCCTGCCATGCGTCTGCTGG + Intronic
1004079466 6:12377009-12377031 CTGTCCTGCCATGTATCAGAGGG - Intergenic
1008499186 6:52163571-52163593 GTGTCCTGCCCTGTATCTGCAGG - Intergenic
1008573464 6:52836909-52836931 GAGTCCTGCTATGTATCTGGAGG - Intronic
1010783675 6:79974732-79974754 CCTCCCTGCCATGGATGTGCAGG + Intergenic
1012955712 6:105567716-105567738 CCTTCCTTCCATCTATCTTCTGG + Intergenic
1017129097 6:151092959-151092981 CCTTCCTGCCACGTATCTCTTGG + Intronic
1017642523 6:156508102-156508124 CCCTCTTGCCGTGTAGCTGCTGG - Intergenic
1017800169 6:157888484-157888506 TGGTCCTGCCATGAATGTGCTGG + Intronic
1022370463 7:29766159-29766181 CAGTCCTGCCACTTATCAGCTGG - Intergenic
1026896014 7:74010465-74010487 CAGTCCTGCCTTGTGGCTGCTGG - Intergenic
1032455926 7:132073454-132073476 AGCTCCTGCCATGTATGTGCAGG - Intergenic
1034328445 7:150259843-150259865 CCCTCCTGCCTTGTCCCTGCTGG + Intronic
1039987898 8:42463519-42463541 CATTCCTGCCATCTAGCTGCTGG + Intronic
1046184079 8:110690354-110690376 CCGGCCGGCCATGCAGCTGCAGG - Intergenic
1047415296 8:124660053-124660075 CCTACCTGCCATGTTTCTGGGGG - Intronic
1048436085 8:134419209-134419231 TGGTCCTGCCATGTATAAGCAGG + Intergenic
1053052355 9:34972324-34972346 TCCTCCTGCCATCTTTCTGCAGG + Exonic
1053279421 9:36808230-36808252 CAGTCCAGTCATGTATCTCCTGG + Intergenic
1053467106 9:38316628-38316650 CCGCCCTGCAATGTGGCTGCAGG + Intergenic
1055372614 9:75616559-75616581 CCATCTTCCCATGTATCTGCTGG - Intergenic
1186634345 X:11386423-11386445 CCTTCCAGCCCTGTAGCTGCTGG - Intronic
1189555610 X:42142218-42142240 CCATCCAGCCATGGAGCTGCTGG + Intergenic