ID: 966913366

View in Genome Browser
Species Human (GRCh38)
Location 3:184571444-184571466
Sequence GGTGAGATGAGGGGGCACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 458}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966913366_966913376 -8 Left 966913366 3:184571444-184571466 CCTCCGTGCCCCCTCATCTCACC 0: 1
1: 0
2: 2
3: 36
4: 458
Right 966913376 3:184571459-184571481 ATCTCACCAGGGCCTGGAGGAGG 0: 1
1: 0
2: 4
3: 34
4: 353
966913366_966913377 -7 Left 966913366 3:184571444-184571466 CCTCCGTGCCCCCTCATCTCACC 0: 1
1: 0
2: 2
3: 36
4: 458
Right 966913377 3:184571460-184571482 TCTCACCAGGGCCTGGAGGAGGG 0: 1
1: 0
2: 8
3: 49
4: 529

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966913366 Original CRISPR GGTGAGATGAGGGGGCACGG AGG (reversed) Intronic