ID: 966913376

View in Genome Browser
Species Human (GRCh38)
Location 3:184571459-184571481
Sequence ATCTCACCAGGGCCTGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 353}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966913359_966913376 9 Left 966913359 3:184571427-184571449 CCTCCCCCCACTTCCAGCCTCCG 0: 1
1: 0
2: 3
3: 104
4: 964
Right 966913376 3:184571459-184571481 ATCTCACCAGGGCCTGGAGGAGG 0: 1
1: 0
2: 4
3: 34
4: 353
966913361_966913376 5 Left 966913361 3:184571431-184571453 CCCCCACTTCCAGCCTCCGTGCC 0: 1
1: 0
2: 3
3: 69
4: 579
Right 966913376 3:184571459-184571481 ATCTCACCAGGGCCTGGAGGAGG 0: 1
1: 0
2: 4
3: 34
4: 353
966913362_966913376 4 Left 966913362 3:184571432-184571454 CCCCACTTCCAGCCTCCGTGCCC 0: 1
1: 0
2: 1
3: 37
4: 489
Right 966913376 3:184571459-184571481 ATCTCACCAGGGCCTGGAGGAGG 0: 1
1: 0
2: 4
3: 34
4: 353
966913363_966913376 3 Left 966913363 3:184571433-184571455 CCCACTTCCAGCCTCCGTGCCCC 0: 1
1: 0
2: 1
3: 30
4: 402
Right 966913376 3:184571459-184571481 ATCTCACCAGGGCCTGGAGGAGG 0: 1
1: 0
2: 4
3: 34
4: 353
966913366_966913376 -8 Left 966913366 3:184571444-184571466 CCTCCGTGCCCCCTCATCTCACC 0: 1
1: 0
2: 2
3: 36
4: 458
Right 966913376 3:184571459-184571481 ATCTCACCAGGGCCTGGAGGAGG 0: 1
1: 0
2: 4
3: 34
4: 353
966913364_966913376 2 Left 966913364 3:184571434-184571456 CCACTTCCAGCCTCCGTGCCCCC 0: 1
1: 0
2: 3
3: 63
4: 805
Right 966913376 3:184571459-184571481 ATCTCACCAGGGCCTGGAGGAGG 0: 1
1: 0
2: 4
3: 34
4: 353
966913365_966913376 -4 Left 966913365 3:184571440-184571462 CCAGCCTCCGTGCCCCCTCATCT 0: 1
1: 1
2: 0
3: 35
4: 402
Right 966913376 3:184571459-184571481 ATCTCACCAGGGCCTGGAGGAGG 0: 1
1: 0
2: 4
3: 34
4: 353
966913360_966913376 6 Left 966913360 3:184571430-184571452 CCCCCCACTTCCAGCCTCCGTGC 0: 1
1: 0
2: 5
3: 56
4: 785
Right 966913376 3:184571459-184571481 ATCTCACCAGGGCCTGGAGGAGG 0: 1
1: 0
2: 4
3: 34
4: 353
966913358_966913376 17 Left 966913358 3:184571419-184571441 CCATTAGGCCTCCCCCCACTTCC 0: 1
1: 0
2: 1
3: 31
4: 287
Right 966913376 3:184571459-184571481 ATCTCACCAGGGCCTGGAGGAGG 0: 1
1: 0
2: 4
3: 34
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966913376 Original CRISPR ATCTCACCAGGGCCTGGAGG AGG Intronic