ID: 966913907

View in Genome Browser
Species Human (GRCh38)
Location 3:184574614-184574636
Sequence GCAGCATGAAGCTGGCTGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966913903_966913907 -1 Left 966913903 3:184574592-184574614 CCCTAGGCGTGAGAGGGGCTTGG 0: 1
1: 0
2: 0
3: 5
4: 92
Right 966913907 3:184574614-184574636 GCAGCATGAAGCTGGCTGCGAGG 0: 1
1: 0
2: 1
3: 15
4: 200
966913905_966913907 -2 Left 966913905 3:184574593-184574615 CCTAGGCGTGAGAGGGGCTTGGC 0: 1
1: 0
2: 0
3: 12
4: 133
Right 966913907 3:184574614-184574636 GCAGCATGAAGCTGGCTGCGAGG 0: 1
1: 0
2: 1
3: 15
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966913907 Original CRISPR GCAGCATGAAGCTGGCTGCG AGG Intronic