ID: 966915832

View in Genome Browser
Species Human (GRCh38)
Location 3:184583721-184583743
Sequence CGCCGCAGCCGGCCCGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 364}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966915817_966915832 10 Left 966915817 3:184583688-184583710 CCTTAGTATTCCCCCCACGGAGC 0: 1
1: 0
2: 0
3: 2
4: 39
Right 966915832 3:184583721-184583743 CGCCGCAGCCGGCCCGGGGGAGG 0: 1
1: 0
2: 2
3: 42
4: 364
966915819_966915832 -1 Left 966915819 3:184583699-184583721 CCCCCACGGAGCCCAGCCGCGCC 0: 1
1: 0
2: 3
3: 21
4: 224
Right 966915832 3:184583721-184583743 CGCCGCAGCCGGCCCGGGGGAGG 0: 1
1: 0
2: 2
3: 42
4: 364
966915820_966915832 -2 Left 966915820 3:184583700-184583722 CCCCACGGAGCCCAGCCGCGCCG 0: 1
1: 0
2: 1
3: 12
4: 164
Right 966915832 3:184583721-184583743 CGCCGCAGCCGGCCCGGGGGAGG 0: 1
1: 0
2: 2
3: 42
4: 364
966915818_966915832 0 Left 966915818 3:184583698-184583720 CCCCCCACGGAGCCCAGCCGCGC 0: 1
1: 0
2: 2
3: 14
4: 196
Right 966915832 3:184583721-184583743 CGCCGCAGCCGGCCCGGGGGAGG 0: 1
1: 0
2: 2
3: 42
4: 364
966915814_966915832 16 Left 966915814 3:184583682-184583704 CCCGCTCCTTAGTATTCCCCCCA 0: 1
1: 0
2: 1
3: 14
4: 146
Right 966915832 3:184583721-184583743 CGCCGCAGCCGGCCCGGGGGAGG 0: 1
1: 0
2: 2
3: 42
4: 364
966915822_966915832 -4 Left 966915822 3:184583702-184583724 CCACGGAGCCCAGCCGCGCCGCC 0: 1
1: 0
2: 3
3: 43
4: 364
Right 966915832 3:184583721-184583743 CGCCGCAGCCGGCCCGGGGGAGG 0: 1
1: 0
2: 2
3: 42
4: 364
966915821_966915832 -3 Left 966915821 3:184583701-184583723 CCCACGGAGCCCAGCCGCGCCGC 0: 1
1: 0
2: 1
3: 6
4: 132
Right 966915832 3:184583721-184583743 CGCCGCAGCCGGCCCGGGGGAGG 0: 1
1: 0
2: 2
3: 42
4: 364
966915815_966915832 15 Left 966915815 3:184583683-184583705 CCGCTCCTTAGTATTCCCCCCAC 0: 1
1: 0
2: 0
3: 15
4: 172
Right 966915832 3:184583721-184583743 CGCCGCAGCCGGCCCGGGGGAGG 0: 1
1: 0
2: 2
3: 42
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966915832 Original CRISPR CGCCGCAGCCGGCCCGGGGG AGG Intronic
900120126 1:1045298-1045320 AGCCGCACCAGGCCCGGGGTCGG - Intronic
900190008 1:1349287-1349309 CGCCGCTCCCGGGCCGGGGGCGG - Intronic
900243890 1:1629077-1629099 CGCCGGGGCAGGCCCGAGGGAGG - Intronic
900690800 1:3979104-3979126 TGCAGCAGCTGGCCCGGGGCCGG - Intergenic
900746826 1:4366302-4366324 CGCTGCAGAGGGCCCGGGGCAGG + Intergenic
901016703 1:6235991-6236013 CGCCGATGCCGGCCCGGGAAGGG + Intergenic
901024142 1:6270203-6270225 GGCAGCAGCCGGGCCGTGGGTGG - Intronic
903324736 1:22563445-22563467 CGCCGCCGCCGCCCCGGGCGGGG - Intergenic
903350014 1:22711490-22711512 CACCGCGGCCGGCCGGGGTGGGG + Intronic
903450748 1:23452212-23452234 TGCCCCAGACGGCCCAGGGGAGG - Intronic
903542639 1:24105566-24105588 CCCCGCAGCCAGCCTGGGGCTGG - Intronic
904642008 1:31938133-31938155 CGCCGCCGCCGGGCCGGGCCGGG - Exonic
905137224 1:35808613-35808635 CGCCCCAGCCGGCCGTTGGGTGG + Intronic
905347006 1:37318146-37318168 CGACGCAGACGGCTCCGGGGAGG - Intergenic
905584350 1:39105340-39105362 CGCTGCAGCCGCGCCGGGGCGGG + Intronic
905912255 1:41662710-41662732 CGCCGGAGCCGGGGCGGGCGCGG - Intronic
906213134 1:44023352-44023374 CACCGCACCCGGCCTGGGTGAGG - Intronic
906214324 1:44030366-44030388 GGCCGGTGCCGGCCCGGGGGCGG - Intronic
906637010 1:47416484-47416506 CGCCGCCGCCGCCCCGGGCCGGG - Exonic
907038359 1:51236447-51236469 GGCCGCCGCCGCCCCGCGGGGGG + Exonic
907429931 1:54405902-54405924 CGCCGCCGCCGGGCTGCGGGCGG - Intronic
909440705 1:75692481-75692503 CACCGCAGCCGGCCCGAGGATGG + Intergenic
912246334 1:107965115-107965137 CGCCCCGGCCGGCTCGGCGGCGG + Exonic
912381322 1:109249662-109249684 CGCCGGGGCCGGGCCGGGGTCGG + Intergenic
913600244 1:120415283-120415305 CGCCGCGCCAGGCCGGGGGGCGG + Intergenic
914374641 1:147062159-147062181 CGCCACAGCTGGCCGGGCGGGGG - Intergenic
914919542 1:151838221-151838243 CGCCGCCGCCGCTCCCGGGGCGG + Exonic
915555253 1:156657597-156657619 CACCGCAGACCGCCCGGGAGCGG + Intronic
918105616 1:181413196-181413218 CCCCGCAGCCGGGCAGGGGGCGG - Intronic
918616572 1:186551025-186551047 GGCTGCAGCCGGGCCGGGGGAGG - Intergenic
919463246 1:197902942-197902964 CGCCGCGGCCGCCCCGGGCTCGG + Intronic
920418411 1:205813464-205813486 CGGCGCAGCGGGCCCGGGGGCGG - Intronic
920528340 1:206684909-206684931 CGCGGCCGCCGGCCCGGGGCTGG + Intergenic
921089654 1:211830672-211830694 CGCCACAGCCGGAGCGGGGCAGG - Exonic
922416667 1:225428233-225428255 CGCCCCACCCTGCCTGGGGGCGG + Intronic
922802678 1:228371453-228371475 GGCGGCACCCGGCCCGGCGGCGG + Exonic
923268767 1:232336005-232336027 CTCCCCAGCAGGCCTGGGGGTGG + Intergenic
924560552 1:245154356-245154378 CCCCCCGGCCGGCCCGGGGTCGG + Intergenic
1062820004 10:527845-527867 CACCGCAGCTGGCCCAGGGACGG - Intronic
1062939182 10:1409148-1409170 CCCCGCATCCAGCCCGGGGCAGG + Intronic
1063458771 10:6202762-6202784 CGCCGTCGCCGGCCCGCAGGGGG + Intronic
1063623016 10:7666732-7666754 CTCCGCGGCCGGGCCGGCGGAGG + Intronic
1064443104 10:15371055-15371077 AGCCGCCGCCGGCCCCGCGGCGG - Exonic
1067071876 10:43138453-43138475 CGCGGCGGCGCGCCCGGGGGTGG + Intergenic
1069769355 10:70887925-70887947 CCCCGCCCCCGCCCCGGGGGTGG + Intronic
1070179097 10:73997798-73997820 GGCGGGAGGCGGCCCGGGGGCGG + Intergenic
1070570735 10:77637992-77638014 AGCCGGGGCGGGCCCGGGGGCGG - Intronic
1070954384 10:80454625-80454647 AGCCGCGGCGGGCCCGGGGCCGG + Intronic
1071573781 10:86711667-86711689 CGCCGCCCTCGGCCCGGAGGAGG - Intronic
1072562298 10:96587117-96587139 CACCGCCGCCGGGCCGAGGGAGG + Intronic
1073207387 10:101776201-101776223 CGCCGCACCGGGCGCGAGGGGGG + Intronic
1076638910 10:131901015-131901037 CGCCGCCGCCGCCGCCGGGGAGG - Exonic
1076850079 10:133088348-133088370 CGCCGCGGCCGGGCTGGGGCGGG + Intronic
1076986103 11:236913-236935 CGCCGTAGCAGGCCGGGGGCGGG - Intronic
1077076799 11:705834-705856 CGCCCCAGCAGGCCGGGGGACGG - Intronic
1077323908 11:1955264-1955286 CGCCGTAGCCGGCCTGCAGGAGG - Intronic
1078164527 11:8870963-8870985 CGCCGCGCCCGGCCCGGCTGGGG - Intronic
1078561722 11:12378050-12378072 CGCCCCCGCCGGGCCGTGGGCGG + Intronic
1078987052 11:16607055-16607077 CGCGGCTGCCGGGCCGGGGCGGG - Intronic
1079251684 11:18791849-18791871 GGCGGAAGCCCGCCCGGGGGCGG - Intronic
1079362000 11:19777278-19777300 CGCAGCAGCGGCCCCGGGGCGGG + Intronic
1080551374 11:33376316-33376338 TGCAGGAGCCGGCCCGGGGGAGG + Intergenic
1080886850 11:36376004-36376026 CGGGGCAGCTGGGCCGGGGGCGG + Exonic
1081645698 11:44788733-44788755 CACCGCACCCGGCCTGGAGGAGG + Intronic
1081812745 11:45922672-45922694 CGCAGCCGCCGGCCAGGGTGCGG - Intronic
1081969096 11:47186123-47186145 TTCCGCAGGCCGCCCGGGGGAGG - Intronic
1083658504 11:64241585-64241607 CGGGGCTGCAGGCCCGGGGGCGG + Intronic
1084000258 11:66292105-66292127 GGCCGGAGCCGGGCCTGGGGCGG + Intronic
1084054863 11:66625622-66625644 CGTCGTAGCTGGCCCGGGGTGGG - Exonic
1084262821 11:67990390-67990412 CACCCCAGCAGGCCCGGGGCTGG - Intergenic
1084304410 11:68272116-68272138 GGCCCGAGCCGGCCCCGGGGAGG - Intergenic
1084438412 11:69157233-69157255 CGCAGCAGCAGGCCCGGGATGGG - Intergenic
1084810572 11:71608715-71608737 CACCCCAGCAGGCCCGGGGCTGG + Intergenic
1084973128 11:72781948-72781970 CGCCCCCGCCGGCCCTGGGAGGG + Intronic
1085312786 11:75526014-75526036 GCCCGCAGCCGGCCGGGGGCGGG - Intergenic
1085561267 11:77474205-77474227 CGCCGCCGCCGCGCCGGGGAGGG - Intronic
1086187273 11:84033746-84033768 TGCCACAGCCGGGCCGGGCGCGG + Intronic
1089580891 11:119481522-119481544 CGCCGCGGTCGGCCAGGAGGTGG + Intergenic
1202806894 11_KI270721v1_random:10459-10481 CGCCGTAGCCGGCCTGCAGGAGG - Intergenic
1094573085 12:31659210-31659232 CGCCGCGGCCCGGCAGGGGGCGG - Intronic
1096039301 12:48500379-48500401 CGGGGCAGCTGGCCCGGCGGAGG + Intergenic
1096536619 12:52279108-52279130 CGCCGGAGCCTGCTCGGGGCTGG - Intronic
1097107694 12:56635028-56635050 CGCCGCCGCCGGCCCAGGGCTGG - Intronic
1097191523 12:57221656-57221678 CGCTGCTGTCGGCGCGGGGGCGG - Intronic
1097990260 12:65825591-65825613 CGCGGCGGGCGGCCCGGGGAAGG + Intronic
1099202012 12:79689692-79689714 GGCCGCAGCCGGACCGGGCCGGG - Intronic
1100309237 12:93378494-93378516 CCCCGCAGCCTGCGCAGGGGCGG - Intronic
1100444820 12:94650585-94650607 CGCCGCCGCCGCCGCGGGGTGGG + Intergenic
1100565630 12:95790915-95790937 TGCCGCTGCCGCCCGGGGGGGGG + Intronic
1103119743 12:118371671-118371693 CGCCGCAGCCGTTCTTGGGGGGG + Intronic
1103261935 12:119595173-119595195 TGCAGCAGCTGGCCCGGGGGTGG + Intronic
1103400725 12:120641167-120641189 CGCTGCCGCCGGCCCGCGGGCGG + Exonic
1103433023 12:120904098-120904120 CGCCGCCGCCGCCGCGGGTGAGG - Exonic
1103509844 12:121466957-121466979 GCCCGCAGCCGGCCCGGGCAGGG - Intronic
1103509926 12:121467265-121467287 CGCCGCCGCCCGCCCGGAGCAGG + Intronic
1103649638 12:122422634-122422656 CGCCGCCGCCGCCGCGGGGCCGG + Intergenic
1104049575 12:125186533-125186555 CGGGGCAGCCGGCCAGGGCGCGG + Intergenic
1104049650 12:125186803-125186825 GGCGGCGCCCGGCCCGGGGGCGG - Intergenic
1104633540 12:130424385-130424407 GGCCGCTGCTGGCCCGGCGGCGG - Intronic
1105459170 13:20567365-20567387 CGCCCCTGTCGGCCCCGGGGCGG + Intronic
1105502879 13:20988334-20988356 CTCCGCAGCCGGGGCGGGGGCGG + Exonic
1107720828 13:43246486-43246508 CTCCTCAGCCAGCCCGTGGGTGG - Intronic
1108541503 13:51451742-51451764 CGCCGCTGCCGGGCCGGGCCGGG + Intronic
1110318360 13:74134837-74134859 CGCCGCACCCGCCCGGGTGGGGG + Intergenic
1113615536 13:111677911-111677933 GGACGCAGCCGGCCCAGGAGGGG + Intergenic
1113621004 13:111762813-111762835 GGACGCAGCCGGCCCAGGAGGGG + Intergenic
1113655908 13:112067730-112067752 CGCCGCCGCCCGCCCCGGCGGGG - Exonic
1116958190 14:50944640-50944662 GGCCGCAGTGGGCTCGGGGGTGG + Exonic
1117176765 14:53153339-53153361 CGGCGCACGCGGCCGGGGGGCGG - Intergenic
1117478406 14:56119072-56119094 CGCCGCGTCCGGGCCGGGGAGGG + Intronic
1117690396 14:58299352-58299374 CGCCACCGCGGGCCCGGGGCGGG + Intronic
1118992459 14:70809108-70809130 CGCCGCTGCCGCCCCGCCGGGGG - Exonic
1119522154 14:75294328-75294350 CTGCGCCGCCGGCCCGGGGTAGG + Intergenic
1120985456 14:90330963-90330985 CGCTGCATCCTGCCCTGGGGTGG - Intronic
1120993362 14:90397563-90397585 CGCTGCAGGCAGCCCGGGTGCGG - Intronic
1122436725 14:101706004-101706026 CGCCGCGGCCGGGCATGGGGAGG + Intergenic
1122444962 14:101761611-101761633 CGGGGCGGCCGGCCGGGGGGTGG + Intergenic
1122877816 14:104677027-104677049 CTCCTCAGGCGGCCCTGGGGCGG - Intergenic
1123024930 14:105420017-105420039 CGCCGCCGCCGGCCCGGACATGG + Exonic
1125510726 15:40291140-40291162 CGCCGGAGCCGCGCCGGGCGAGG - Exonic
1125834446 15:42737144-42737166 CGCCGCGGGCGGCCAGGGAGGGG + Intergenic
1126766999 15:52019431-52019453 CGCCGCGGCGGGCCCGGCGGCGG + Intronic
1127606225 15:60591519-60591541 CTCCGTAGCCGGGCCGGGGGCGG - Intronic
1129348277 15:74938163-74938185 CGCCGCCGCCGGCCGCGCGGTGG - Exonic
1129658716 15:77541473-77541495 TGCCCCAGCAGGCCCGGGTGTGG + Intergenic
1130296147 15:82648021-82648043 CTCCGCATCCGGCCGGGGGGCGG - Intronic
1131144492 15:90002213-90002235 CGTCCCAGCCGGCCGGGGGTGGG + Intronic
1131153185 15:90059632-90059654 AGCTGCCGCCGGCACGGGGGAGG - Intronic
1131969363 15:97876310-97876332 TGCCCCAGCTGGCTCGGGGGTGG - Intergenic
1132342916 15:101089202-101089224 CCCCGCAGCCGGCCCCCAGGCGG - Intergenic
1132828957 16:1918331-1918353 CGCCGCTCCAGGCCCGGGAGCGG + Exonic
1133097590 16:3458043-3458065 GGCCGCAGCCGGGACGGAGGCGG - Intronic
1133297682 16:4762858-4762880 GGCTGCAGACAGCCCGGGGGTGG - Intronic
1133784468 16:8963683-8963705 CGCCGCGCCCGGCCCGAGGCGGG - Intronic
1133924524 16:10182357-10182379 CCCAGCAGCCGGCGCTGGGGAGG - Intronic
1134042150 16:11076847-11076869 CTCCCCAGCAGGCCCTGGGGTGG - Intronic
1134490620 16:14693221-14693243 CGCTGCAGCCTCCTCGGGGGAGG + Intronic
1134496001 16:14732338-14732360 CGCTGCAGCCTCCTCGGGGGAGG + Intronic
1136229878 16:28879888-28879910 CGCCGCAGCCGGCATCGCGGCGG - Intronic
1136428223 16:30183264-30183286 CGGCGCAGCCGGGCCGGGGCGGG + Intronic
1138591183 16:58000532-58000554 GGCTGCGGCCGGACCGGGGGCGG + Intronic
1141054526 16:80803713-80803735 CGCCGCGGCCGGCGGGGGTGTGG - Intronic
1141694533 16:85613406-85613428 CGCCGCACCCGGCCGGGGACGGG + Intronic
1141727402 16:85799151-85799173 CGCCGGGGCCGCCCAGGGGGAGG + Exonic
1142239546 16:88938961-88938983 CGCCGCTGCCGCCTCTGGGGTGG - Intronic
1142275526 16:89116767-89116789 CGCGGGAGCCGGCCCAGGGCAGG - Intronic
1142377152 16:89712011-89712033 CCCCGCAGCGGCCCCAGGGGCGG + Intronic
1142586868 17:979468-979490 CGCGGCGGCCGGGCCGGGGCCGG - Exonic
1142611107 17:1109531-1109553 GGCCGCGGCCGGGCCGGGGTGGG + Intronic
1142764326 17:2057101-2057123 CGCCGCCGCCGCCCCGCAGGTGG - Exonic
1142812174 17:2400528-2400550 CTCCGCAGGCCGCCCGGGAGGGG + Intronic
1142942038 17:3387510-3387532 CTCCGCATCCAGCCCAGGGGAGG + Intergenic
1142957464 17:3531527-3531549 CGCTGTGGCCGGCCCGGGGGAGG - Intronic
1144020948 17:11240257-11240279 CTCTGCAGCCGGCCCGCGGCAGG - Intergenic
1144756182 17:17681833-17681855 CGCCGCCCCCGCCCCGGGGCAGG - Intronic
1146332335 17:31937416-31937438 CGCCGCTGCCGCCGCGGAGGAGG - Exonic
1147967389 17:44200331-44200353 CGTCCCGGCCGGCTCGGGGGCGG + Intergenic
1147996599 17:44363247-44363269 CGCCCCAGCCCGCCCCTGGGCGG + Intronic
1148081696 17:44970450-44970472 TGCCCCGGCCGGCGCGGGGGTGG - Intergenic
1148090263 17:45019100-45019122 CGGCGCGGGCGGCCCGGGCGGGG + Intergenic
1148334463 17:46832276-46832298 CAGCTCAGCCGGCCCGGGGTGGG - Intronic
1148632864 17:49125712-49125734 CGGGGCGGCCGGCCCGGCGGGGG - Intergenic
1148733434 17:49851381-49851403 CGCGGGAGCCGGGCCGGGGGCGG + Intergenic
1148818228 17:50346000-50346022 CGCCGGGGCGGGGCCGGGGGCGG - Intergenic
1149780585 17:59394119-59394141 CGCGGCAGCTGGCCAGGCGGGGG + Intronic
1151612047 17:75182688-75182710 AGCCGCGGCCGGCCCCGTGGGGG + Intergenic
1151852961 17:76701751-76701773 CGCAGCAGTCGGCCCTGGGCAGG - Intronic
1152345447 17:79748231-79748253 CGTGGCAGCCGGCGAGGGGGAGG - Intergenic
1152357399 17:79813720-79813742 GGCCCCCGCCGGCCCGGGGCGGG - Intergenic
1152433101 17:80260503-80260525 CGCCGCCGCCGGCCCCGCGCAGG - Intergenic
1152777746 17:82213103-82213125 CGCCGCCCCCGGCCCGGCCGAGG + Intergenic
1152870881 17:82752406-82752428 CGCCGAACCCGGGCCGGGGGAGG - Intronic
1154092449 18:11378319-11378341 CGGCTCCGCCGGCCCAGGGGAGG + Intergenic
1154115257 18:11608765-11608787 CGGGGCAGCCGGCCGGGCGGGGG - Intergenic
1154492625 18:14933383-14933405 GACAGCAGCAGGCCCGGGGGTGG + Intergenic
1155238981 18:23847573-23847595 CTTCGCAGCCGGCCATGGGGTGG - Exonic
1156099629 18:33578369-33578391 CGCGGCGGGCGGGCCGGGGGCGG - Intergenic
1157849005 18:51030358-51030380 CTCCGCGGCCGCCCAGGGGGTGG + Exonic
1159040650 18:63320309-63320331 CGCCGCGGCAGGCCCGGGAGTGG + Intergenic
1160404812 18:78638133-78638155 CGCCCCGGCCGGCCTGGGGCTGG + Intergenic
1160453385 18:78979906-78979928 CGCCACAGCCGCACCCGGGGCGG + Intergenic
1160738562 19:675832-675854 CGCTGGAGCCGGCCTGTGGGTGG - Intergenic
1160909866 19:1469461-1469483 GGCCGCTGCCGGGCCGGGGCCGG - Exonic
1161400650 19:4065349-4065371 CGCTGCGGCCGGGGCGGGGGAGG - Intronic
1161967334 19:7555735-7555757 CGAAGCAGCGGGCCCGGGAGTGG + Exonic
1162200351 19:9015467-9015489 CACCGCACCCGGCCAGGGAGTGG + Intergenic
1162752650 19:12838409-12838431 GGCTGCAGCCGGCCGGGAGGGGG - Intronic
1162962498 19:14136299-14136321 GGCCGGGGTCGGCCCGGGGGTGG + Intronic
1163111119 19:15161388-15161410 GGCCGCAGGGGCCCCGGGGGCGG - Exonic
1163123498 19:15232043-15232065 CGCAGCAGCCGCGCCGGGGCCGG + Exonic
1164401327 19:27904338-27904360 AGCTGCAGCCTGCCCCGGGGTGG - Intergenic
1165058635 19:33194454-33194476 CGCCGCGGCCGGCCTGGGCCCGG - Intronic
1165167721 19:33868942-33868964 CGACGCTGCCTGCCCGGGAGCGG + Intergenic
1166303819 19:41926698-41926720 CGCGGCGGCCGGCCGGGAGGGGG + Intronic
1166304100 19:41928008-41928030 CGCCGCGGCCGGCGCAGGGGCGG - Intronic
1166389638 19:42401859-42401881 CGCCGGAGCCGGGCCGAGCGGGG - Exonic
1166993834 19:46709647-46709669 CACCGCACCCGGCCCAGTGGAGG + Intronic
1167040618 19:47020828-47020850 CACCCTAGCCGGCCCGGGGCTGG - Intronic
1167217092 19:48171819-48171841 CCCCGCAGCCGTGCCGGGTGGGG - Exonic
1167286940 19:48603649-48603671 CGCGGCAGGCGGCCAGGCGGTGG + Exonic
1167466893 19:49654794-49654816 CGTGGCAGCCAGCCCGGTGGGGG - Exonic
1167619976 19:50555335-50555357 CACCGCAGCTGCCCCGGGAGAGG + Intronic
1168247011 19:55117504-55117526 CCCGGCGGCTGGCCCGGGGGCGG - Exonic
1168594503 19:57664447-57664469 CGCAGCACCCGGGGCGGGGGAGG + Intergenic
1168654695 19:58118473-58118495 GGCCGGGGCCGGCCCGGGGCGGG + Intergenic
925266930 2:2572037-2572059 CGCAGCAGCGGGCCCGGCGGAGG + Intergenic
927937967 2:27086118-27086140 TGCCGCTGCGGGCCCGGGTGCGG - Exonic
927990342 2:27442769-27442791 CGCGGCAGGCGACCCGGGCGGGG + Intronic
928606161 2:32946989-32947011 CGCCGCAGCGGGGCCCGGCGAGG - Exonic
928904626 2:36356246-36356268 CCTCGCAGCCGGGCCGGGAGCGG - Exonic
928964828 2:36966344-36966366 CGCCGCAGCCGCCCCGTCGCCGG + Exonic
930124093 2:47783034-47783056 CGTCGCCGCGCGCCCGGGGGCGG + Intronic
930143162 2:47973923-47973945 GGCTGCAGCCTGCTCGGGGGAGG + Intergenic
931690664 2:64832191-64832213 GGCCACAGGCGGCCCGTGGGTGG - Intergenic
933666946 2:84971515-84971537 CGCCGCGCCCGGCCCGGGCGGGG - Intronic
934467092 2:94273028-94273050 CGCGGCAGCGGGGGCGGGGGCGG + Intergenic
936775334 2:115965735-115965757 GGCTGCAGCCGGGCGGGGGGAGG - Intergenic
937044017 2:118841612-118841634 CGAAGCAGCAGGTCCGGGGGCGG - Intergenic
938157796 2:128956381-128956403 CGCAGCAGCAGGCCTGGGGATGG - Intergenic
940316700 2:152335096-152335118 GGGCGGAGCCGGGCCGGGGGCGG + Intergenic
940751225 2:157628867-157628889 CCCCGCAGCCGGGCGGGGAGCGG + Exonic
941951376 2:171160454-171160476 CGCCGCTGCCGTCGCAGGGGGGG - Exonic
942042999 2:172083258-172083280 CGCCGCGGCGGGCGCGGGGTCGG - Intergenic
942947325 2:181684308-181684330 CGGCGCCTCCGCCCCGGGGGAGG + Intergenic
944676017 2:202034513-202034535 CGCCGGGGCCGGGCCGTGGGCGG - Intergenic
945225877 2:207530484-207530506 CGCCGCCGCCGGGCCGGGCGCGG + Intronic
945225878 2:207530486-207530508 CTCCGCGCCCGGCCCGGCGGCGG - Intronic
945225890 2:207530515-207530537 ACCCGGAGCCGCCCCGGGGGAGG + Intronic
946747482 2:222860883-222860905 CGGCGCTGGCGGCCCGGGGCGGG - Intergenic
948386105 2:237582035-237582057 CTCCGCAGCAGGCCCTGGCGGGG + Intronic
948824789 2:240568906-240568928 CGCGGGCCCCGGCCCGGGGGCGG - Exonic
948953793 2:241272309-241272331 CGCCCCCGCCGGAGCGGGGGAGG + Intronic
1168814647 20:728305-728327 CTCCGCAGCTGGCCCGGAGTCGG - Intergenic
1169065506 20:2692679-2692701 CGGCGCGGCCGGCCGAGGGGCGG - Intergenic
1169214732 20:3786516-3786538 CGCCGCCGCCGCCCCGGGGCGGG + Exonic
1169247004 20:4032935-4032957 CGGGGCAGCCGGCCGGGCGGGGG - Intergenic
1170150362 20:13221304-13221326 CGCCGCAGCTGGAGCGGGAGCGG - Intergenic
1172042154 20:32052956-32052978 AGCTGCAGCCGGCCTGGGTGTGG - Intronic
1172118310 20:32584170-32584192 CCGCCCAGCCGGCCCGGGGGCGG + Intronic
1172135342 20:32682943-32682965 CACCGCACCCGGCCAGGGGGAGG - Intergenic
1173279716 20:41617933-41617955 CACCGCGCCCGCCCCGGGGGGGG + Intronic
1173813581 20:45971266-45971288 CGCCGCGGCCGCCCCGGGGCAGG - Exonic
1174246888 20:49188250-49188272 GGGCGCCGCCGGGCCGGGGGGGG + Exonic
1174373919 20:50112951-50112973 CGGCGCGGCCTGACCGGGGGAGG - Intronic
1176100242 20:63361379-63361401 CGCCTCAGCCGGCTGGGAGGGGG + Exonic
1176125227 20:63472079-63472101 CGCCGCAGCCAGCCTGGCCGGGG + Intronic
1178513832 21:33229899-33229921 CGCCGCCGCCGGCGCGGGGGCGG - Intronic
1178992276 21:37366389-37366411 GGCCGCAGTCGGCGCGGGCGCGG + Intronic
1179891812 21:44339081-44339103 GGCCGCGGCCGCCCCGGGGTGGG - Intronic
1180014968 21:45075499-45075521 CGCCGCGGGCGGCCCGGGCCAGG + Intronic
1180156826 21:45982075-45982097 CGCTGCAGCCGCCCCGAGCGGGG - Intronic
1180559167 22:16601783-16601805 TGCTGCGGGCGGCCCGGGGGAGG + Intergenic
1181512984 22:23397103-23397125 CACCGCAGCCAGGCCGGGGCTGG + Intergenic
1181652686 22:24269539-24269561 CGCCGCAGCCGTCCAGGGACTGG - Intergenic
1181745326 22:24952271-24952293 TGCTGGTGCCGGCCCGGGGGCGG - Intergenic
1181804716 22:25367786-25367808 CTCCGGAGCTGGCCCTGGGGTGG - Intronic
1183201418 22:36387763-36387785 CGCCGCCGCCTGCCCGGGGCGGG + Intronic
1183401757 22:37609007-37609029 CCCCGCCCCCGGCCCGGGAGGGG + Intronic
1183401759 22:37609009-37609031 CGCCCCTCCCGGGCCGGGGGCGG - Intronic
1183466716 22:37983820-37983842 CCCGGCGGCTGGCCCGGGGGAGG - Exonic
1183653410 22:39171738-39171760 GCCCCCATCCGGCCCGGGGGTGG - Intergenic
1183739536 22:39662291-39662313 CCCTCCAGGCGGCCCGGGGGTGG - Exonic
1184220356 22:43096025-43096047 AGCCCCAGCCGGGCCGGGTGCGG + Intergenic
1184220357 22:43096027-43096049 CACCGCACCCGGCCCGGCTGGGG - Intergenic
1184523635 22:45009368-45009390 GGCTGGAGCCTGCCCGGGGGCGG - Intronic
1184820376 22:46905527-46905549 CCCTGCAGCCGGCCCCGGGGAGG + Intronic
1185155313 22:49190158-49190180 CACAGGAGCCGGCCCGAGGGAGG + Intergenic
1203238469 22_KI270732v1_random:30916-30938 CGCCGCCGCCGCCGCCGGGGCGG + Intergenic
950743027 3:15064866-15064888 GACTGCAGCCGGCCCGGCGGGGG + Intronic
952241284 3:31533147-31533169 CGCCGAAGCCGGCCCCGGCGGGG + Exonic
953406946 3:42664412-42664434 CGCCGTCGCCGGCCAGGGTGTGG - Exonic
953947671 3:47163656-47163678 GGCCGCAGCAGGCCCGCGGTTGG - Intronic
954912786 3:54122682-54122704 CGCCGCAGCGGGCGCGTCGGAGG + Exonic
955161560 3:56468721-56468743 CGCCGCGGCCTGCCGGGAGGAGG - Intergenic
960577175 3:119240919-119240941 CGCCCCAGCCGCCCGGGAGGCGG + Intronic
960896747 3:122514376-122514398 CGCCGCGGCCGGGCGGCGGGCGG - Intronic
961574300 3:127822528-127822550 CGCCGCTCCCCGCCCTGGGGAGG - Exonic
961654282 3:128432916-128432938 CCCCGCAGGTGGCGCGGGGGAGG - Intergenic
963236740 3:142963700-142963722 CGCCGCCGCCGCCCCCGGAGCGG + Intergenic
964801607 3:160564955-160564977 CGGCGGAGCCGGCCCGGCGCGGG - Intronic
966594201 3:181711781-181711803 CGCCGCCGGCCGCGCGGGGGAGG - Intergenic
966684775 3:182682406-182682428 CGCCGCTTCCTGCCTGGGGGCGG + Intergenic
966860841 3:184230224-184230246 CGCCGCGGCTCCCCCGGGGGTGG - Intronic
966915832 3:184583721-184583743 CGCCGCAGCCGGCCCGGGGGAGG + Intronic
967177674 3:186874451-186874473 CGCGGCAGCTGGCCGGGTGGGGG - Intergenic
967904099 3:194486789-194486811 CGCCGCCGCGGGCGCGGAGGAGG - Intronic
968225220 3:196968839-196968861 CGCCGCCGCCGGCGCAGGGCGGG + Intronic
968701374 4:2059642-2059664 CGCGGCGGCCGGCCCGGGCGCGG - Exonic
969308588 4:6339460-6339482 AGCCTCAGCCAGCCTGGGGGTGG + Intronic
969732534 4:8965111-8965133 CACCCCAGCAGGCCCGGGGCTGG + Intergenic
969792113 4:9499194-9499216 CACCCCAGCAGGCCCGGGGCTGG + Intergenic
970345672 4:15150049-15150071 GGCCGCAGCTGACCCGAGGGTGG - Intergenic
971351915 4:25862920-25862942 CGCGGCGGCCGGCCCGGCCGGGG - Exonic
972376525 4:38476902-38476924 GGCAGCAGCCGGGCTGGGGGAGG + Intergenic
975986179 4:80202905-80202927 GGCCGCAGGCGGCGCGGGCGGGG + Exonic
977511227 4:97965268-97965290 GGCTGCAGCCAGCCAGGGGGAGG + Intronic
982838859 4:160156897-160156919 CGCGGCAGCCAGGCTGGGGGAGG - Intergenic
983221208 4:165046065-165046087 CGCCGCAGCCGTCCAGAGAGCGG + Intergenic
984771965 4:183444320-183444342 CGCCGCAGCTGACCCGGCGGGGG + Intergenic
985068490 4:186145178-186145200 AGACGCAGCCGGCCCGCGGGCGG - Intronic
985727567 5:1524037-1524059 CGCCCCTGCCGGCCGGCGGGAGG - Intergenic
987099679 5:14581420-14581442 CGCAGCAACCTGCCCGCGGGGGG + Intergenic
987132473 5:14872033-14872055 AGCCTCGGCCGGCCCGGGGGCGG + Intergenic
987251888 5:16108623-16108645 CGCCCCAGCTGGCCTGGGGCAGG + Intronic
988891272 5:35619392-35619414 CACCGCACCCGGCCCGGGTGTGG - Intronic
990382995 5:55233760-55233782 CTCCGCGGCCCGCCGGGGGGAGG + Intergenic
992474214 5:77086955-77086977 CGCGACAGCCGGCCCGGAGAAGG + Intronic
993168262 5:84384176-84384198 CGCCGCTGGCGGCGCGGAGGAGG - Intronic
995106370 5:108381457-108381479 CGCCCCCGCCGGCCCAGAGGAGG - Exonic
996862630 5:128083629-128083651 CGCCGCTGCGGGACCGCGGGTGG + Intergenic
998130370 5:139648667-139648689 CGCCGCGGCTGGCCCGAGGCGGG - Exonic
999462925 5:151772221-151772243 CGCCCCAGCCGGGACGGGAGCGG - Intronic
1001100978 5:168814105-168814127 CACCGCACCCGGCCCTGTGGTGG - Intronic
1001280727 5:170384504-170384526 GGCTGCAGCAGGCCCGGGAGAGG + Intronic
1002140345 5:177133918-177133940 CCCCCCAGCTGGCCCGGGAGGGG + Exonic
1002291823 5:178205293-178205315 GGCCGGAGCCGGCGCAGGGGCGG + Intronic
1002431841 5:179208460-179208482 CGCTGCAGTCGGCCCTGGGCAGG + Intronic
1002593107 5:180304626-180304648 CCCCACAGGCGGCCCGGGGGAGG + Intronic
1002645059 5:180648964-180648986 CGCCGTCGCCGGCCACGGGGAGG + Intronic
1003175938 6:3752124-3752146 CGCCCCACCCGGCCCGCGAGGGG + Intergenic
1003290853 6:4776851-4776873 CGGCGCGGCCGGGCCGGGAGGGG - Intronic
1006137090 6:31901885-31901907 GGTCGCTGCCGGCCCCGGGGGGG - Exonic
1006303707 6:33207223-33207245 AGCTGCAGCCGGCCTGGGGTCGG + Intergenic
1006498262 6:34439855-34439877 CGCCGCTGCTGGGCGGGGGGGGG - Intergenic
1007680311 6:43629110-43629132 GGCTGCTGCCGGCCCGGAGGGGG - Exonic
1007739144 6:44000515-44000537 CGCCGCGGCAGGCCAGGGGAGGG + Intergenic
1007902271 6:45422977-45422999 CGCCGCTCCCGGCCGGGGGCGGG - Intronic
1012220019 6:96638173-96638195 GGCAGCAGCCAGGCCGGGGGAGG + Intergenic
1012401208 6:98843875-98843897 CCCCGCGGCCAGCCCGGGCGGGG + Intergenic
1012434884 6:99204700-99204722 GGCCGCAGCCAGGCTGGGGGAGG + Intergenic
1013507596 6:110815345-110815367 CGCCGCCGCCGTCGCGGAGGAGG - Intronic
1014461630 6:121703337-121703359 CGCAGCAGCCTGGCAGGGGGAGG + Intergenic
1015366386 6:132401576-132401598 CCCTGCAGGCGGCCCGGGGCGGG - Intergenic
1015525968 6:134175516-134175538 CGCCGCCGCCGGCCCCGCTGGGG - Intronic
1015842233 6:137488409-137488431 TGGCGCAGGGGGCCCGGGGGCGG - Intergenic
1016657937 6:146543355-146543377 CGCCGACCCCGGCCCCGGGGGGG + Intergenic
1016949488 6:149566350-149566372 GGGCGGAGCCGGCCCGCGGGCGG - Exonic
1017672070 6:156778045-156778067 CGCCGCTGCCGCCGCGGAGGAGG - Exonic
1019474251 7:1236437-1236459 CGCCGCCGCCGCCGCGGGGCTGG + Exonic
1019539958 7:1547011-1547033 CGCCGGAGCCGCCGCTGGGGTGG + Exonic
1019589514 7:1823794-1823816 CGCAGCTGCTGGGCCGGGGGAGG + Intronic
1020238470 7:6374473-6374495 CGGCGGCGCCGGCGCGGGGGAGG + Intergenic
1020308751 7:6854334-6854356 CACCCCAGCAGGCCCGGGGCCGG - Intergenic
1021231099 7:18086896-18086918 CGCCGCCGCCGCCGCGCGGGGGG - Intergenic
1021839830 7:24713545-24713567 AGGCGCAGCAGGCCTGGGGGTGG + Intronic
1021868345 7:24980109-24980131 CCCGCCAGCCGGCCCGGGAGAGG - Exonic
1022528489 7:31052949-31052971 CGCCGCAGACTGCCGGGGTGGGG + Intronic
1024031849 7:45468202-45468224 TGCAGCAGCCAGCCTGGGGGAGG - Intergenic
1025852974 7:65258530-65258552 CGGGGCAGCCGGCCGGGCGGGGG - Intergenic
1025853158 7:65258931-65258953 CGGGGCAGCCGGCCGGGCGGGGG - Intergenic
1025976904 7:66377172-66377194 GGCCGCAGCTGGGCCGGGAGAGG + Intronic
1027982976 7:85250271-85250293 GGCGGCAGCCAGGCCGGGGGGGG + Intergenic
1029699026 7:102234254-102234276 GGACGCAGCCGGCCCGGGCGGGG - Intronic
1029701385 7:102248793-102248815 AGCCGCCGCCGCGCCGGGGGAGG + Exonic
1031629873 7:124033101-124033123 GGCCGCTGCCGGCCCCCGGGGGG + Intergenic
1032151776 7:129435040-129435062 CGCCGCAGGCAGCCTGGGAGGGG - Intronic
1033654374 7:143362821-143362843 CGCCGCGGCCGGGGAGGGGGCGG + Intergenic
1034222860 7:149459747-149459769 CGCCGCGCCCGGGCCGGGGAAGG + Intronic
1034227913 7:149497424-149497446 CGGCGCCGCAGGCCCTGGGGAGG - Intronic
1034469849 7:151249219-151249241 CACCGCCGCCGGCCCCGGGCAGG - Intronic
1034618119 7:152436146-152436168 TGCCGCGGGCGGCTCGGGGGAGG - Intergenic
1036701548 8:11016583-11016605 CGCTGCAGCCAGCCGGAGGGCGG - Intronic
1036751107 8:11444214-11444236 CTCCGCAGCCGGCCTCGGGAAGG + Exonic
1037450722 8:19013800-19013822 CGGCGCAGGCGGGCCGGCGGTGG + Intronic
1037473851 8:19237493-19237515 CTCAGCAGCCGGGCCGGGGAAGG - Intergenic
1037535222 8:19817431-19817453 CGCCGCCGCCACCGCGGGGGAGG - Exonic
1037723843 8:21467155-21467177 CTCCTCAGCTGGCCCGGGAGTGG + Intergenic
1039554728 8:38467870-38467892 CGCCGCAGCCCAGCCGGGGCCGG - Intronic
1040062296 8:43114323-43114345 GGCCGCAGCGAGCCTGGGGGAGG - Intronic
1040372777 8:46794045-46794067 GGCCTCAGAGGGCCCGGGGGAGG + Intergenic
1041107587 8:54458069-54458091 CGCCTCCCCCGACCCGGGGGAGG - Exonic
1041713035 8:60910338-60910360 CGCTGCGGCCGGGCCGGGCGGGG + Intergenic
1046096593 8:109569900-109569922 CCCCGCAGGGGGCCAGGGGGAGG + Intergenic
1048073170 8:131041614-131041636 CCCCGGAACCGGGCCGGGGGTGG + Exonic
1048456788 8:134585602-134585624 TTCCACAGCCGGCCCGTGGGTGG - Intronic
1048626943 8:136195783-136195805 GGCAGCAGCCAGGCCGGGGGTGG - Intergenic
1049082936 8:140457244-140457266 CGCCGCGGACGGCCCGGGAGGGG + Intronic
1049145893 8:141000984-141001006 CGCCGCATCCGCCCCGGGACTGG + Intronic
1049279753 8:141738229-141738251 CCCAGGAGCCGACCCGGGGGTGG + Intergenic
1049411362 8:142475370-142475392 CGCCGAGGCCGGCCCGGGTGGGG - Intronic
1049762704 8:144338247-144338269 CGCCGCTGCCGGGGCCGGGGCGG - Intergenic
1053048186 9:34937037-34937059 CGGGGCGGCTGGCCCGGGGGGGG - Intergenic
1053122992 9:35560254-35560276 CGCTGCAGCTGGCCCGGGCCCGG + Exonic
1053306218 9:36986354-36986376 CGCCGCGGCCGCGCCGGCGGGGG + Intronic
1054175056 9:61869187-61869209 GGCCGGGGCCGGCCTGGGGGAGG + Intergenic
1054662481 9:67711606-67711628 GGCCGGGGCCGGCCTGGGGGAGG - Intergenic
1055044449 9:71910585-71910607 CGCCGCAGCCCGGCTCGGGGAGG - Intronic
1055321641 9:75088383-75088405 CGCCGCAGCAGGAGCGCGGGCGG - Intergenic
1057489149 9:95508373-95508395 CGCCGCCGCCGCCGCGGGGACGG + Exonic
1058053350 9:100427417-100427439 GGCCGCAGCCGGGCGGGGGCGGG + Intronic
1059234493 9:112750683-112750705 CGCCGCGGCCGCCCGGGAGGGGG - Intergenic
1059283089 9:113151163-113151185 CGCTGCCGCTGGCCCGGGGCTGG + Intronic
1059375199 9:113876088-113876110 CGGCGAGGCCGGCCCGGGGGCGG + Intergenic
1060677402 9:125528055-125528077 CACCGCAGCTGGCCCAGGGTTGG - Intronic
1060837489 9:126767383-126767405 CACCGCACCCGGCCTGTGGGTGG + Intergenic
1062022612 9:134326547-134326569 CGGCGCGGCCGGCCCGGGCCCGG - Intronic
1062277228 9:135736736-135736758 CGCTGCTGCCGGCCCGCGGCGGG + Intronic
1186350119 X:8731941-8731963 CGCAGCAGCCGCGCCGGGGCCGG + Exonic
1187698113 X:21940917-21940939 CGCCCCAGCCCGCCAGGCGGCGG - Intronic
1187888040 X:23907556-23907578 GGACGCAGCCGGCCCAGTGGCGG + Intronic
1188000450 X:24975296-24975318 CACCGCACCCGGCCCTTGGGTGG + Intronic
1189534609 X:41923534-41923556 CGCCACCGCCCGCCCGGGAGTGG + Intergenic
1190337259 X:49270023-49270045 CGCCGCTACCGGCCGTGGGGCGG + Exonic
1191085576 X:56563911-56563933 GGCCGCAGCAGGGCCGCGGGAGG - Exonic
1191184225 X:57592518-57592540 GGCCGCGGCGGGGCCGGGGGCGG - Exonic
1191213168 X:57909941-57909963 GGCCGCGGCGGGGCCGGGGGCGG + Exonic
1196918258 X:120561157-120561179 CGCTGCAGCCGCCCGGGGGGCGG + Intronic
1199772660 X:150984197-150984219 CGCCGCTGCGGGCCCTGGAGCGG + Intronic
1200277778 X:154750884-154750906 CCCCGCGGCCGCCCCGCGGGCGG + Intronic