ID: 966920290

View in Genome Browser
Species Human (GRCh38)
Location 3:184606707-184606729
Sequence AAATGACATCAATGGGTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 322}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966920290 Original CRISPR AAATGACATCAATGGGTTAA TGG Intronic
900656283 1:3759792-3759814 AAATGAAATTACTTGGTTAAAGG - Intronic
905040202 1:34949735-34949757 AAATGAAATTAATAGTTTAACGG + Intergenic
905999359 1:42410697-42410719 AAACTTTATCAATGGGTTAATGG - Intronic
907649668 1:56283030-56283052 CAATCACTCCAATGGGTTAATGG - Intergenic
907835496 1:58104634-58104656 AAATTAAATAAATAGGTTAAAGG - Intronic
908321359 1:62981975-62981997 AAATGACATCGATGAAATAAGGG - Intergenic
909719210 1:78748004-78748026 AAATTACATGAATAGATTAAAGG - Intergenic
910340832 1:86185059-86185081 AAATAACATCAATTGGTTTGAGG - Intergenic
910752331 1:90646353-90646375 AAAATATATCAATGGGTTGAAGG + Intergenic
911037181 1:93563433-93563455 AAATGTCATCAATTGGTGAATGG - Intronic
911978690 1:104537539-104537561 AAATGACAACAAAGTGTAAAAGG - Intergenic
912085394 1:105996203-105996225 TAATGACAACTATGGGTTGAGGG - Intergenic
912540236 1:110409293-110409315 AAATGGAATGACTGGGTTAAAGG + Intergenic
913353211 1:117885966-117885988 AAATGAAATTAATAGATTAATGG + Intronic
913507917 1:119535244-119535266 AAAAGACATCAATAAGATAATGG + Intergenic
916498219 1:165364570-165364592 ATATGAAATCAATGAGATAATGG - Intergenic
916868929 1:168890832-168890854 AACAGACTTCAAAGGGTTAATGG + Intergenic
917296585 1:173525859-173525881 AAATGGCAACAATGGGTCATGGG + Intronic
917317916 1:173746085-173746107 AAGTTACATTAATGGGTTTAAGG - Intronic
919026901 1:192183825-192183847 AAATAACTTCAATTGGTTCATGG + Intronic
919104547 1:193132865-193132887 AAATGACATAGATGGATAAAGGG - Intronic
920796758 1:209145237-209145259 GAATGACATGATTAGGTTAAAGG + Intergenic
921035417 1:211373618-211373640 AAATGTCATAAATGGATAAAAGG + Exonic
921526424 1:216223845-216223867 AATTGAGATCAATCGGATAAAGG + Intronic
921560759 1:216655471-216655493 AAATGACTACACTGGGGTAAAGG + Intronic
921783185 1:219193160-219193182 ACATGACATCAATTGATTCAAGG - Exonic
923089195 1:230726432-230726454 AAATGACACCTATGGGTGAAGGG - Intergenic
923582916 1:235235557-235235579 AAATAACATACATGGGTGAATGG - Intronic
1063124588 10:3127399-3127421 GAATGACATCAACCGCTTAATGG - Intronic
1063443526 10:6092512-6092534 AAATTACATGAATGGGTTGGGGG + Intronic
1063895298 10:10674889-10674911 AAATGACAGCAATGGTACAAGGG - Intergenic
1065073477 10:22052179-22052201 AAAGGAAGTCAATGTGTTAAAGG - Intergenic
1066596889 10:37060976-37060998 AAATGTCATCACTCTGTTAAAGG + Intergenic
1067291253 10:44944111-44944133 TAATGACAACAATGTGTTACTGG - Intergenic
1067396420 10:45923995-45924017 AAATGAAATTAATGGGTAATAGG + Intergenic
1067864740 10:49893101-49893123 AAATGAAATTAATGGGTAATAGG + Intronic
1067907052 10:50303312-50303334 GAATGACATCAATGTTCTAAGGG + Intergenic
1068187856 10:53610450-53610472 AAGTGTCATCAGTGGGTGAATGG - Intergenic
1068457828 10:57281749-57281771 AAATGTCATTAATAGATTAATGG + Intergenic
1068618302 10:59146751-59146773 TAATGACTTCAATGGGTTGAAGG - Intergenic
1069616426 10:69809236-69809258 AAATGAAATCATTTGGCTAATGG + Intronic
1070183489 10:74037309-74037331 TTCTGTCATCAATGGGTTAATGG + Intronic
1071148597 10:82605351-82605373 CTATCATATCAATGGGTTAAAGG - Intronic
1071890161 10:89996136-89996158 AAATGACATCAAATGGTTGAAGG - Intergenic
1072846138 10:98832431-98832453 AAATGACAACAATGGTTTCTAGG + Intronic
1073561574 10:104501589-104501611 AAATGAAATCAATATGTCAAAGG - Intergenic
1075159070 10:120007285-120007307 AAATTATATTAATGGGTTAAGGG + Intergenic
1076130858 10:128012777-128012799 AAAAGACTTCAGTGGGTTCAAGG - Intronic
1078589235 11:12624090-12624112 AAATCACATTAATAGATTAAAGG + Intergenic
1078681153 11:13477388-13477410 GAATGTCATCAATGTGTTAATGG + Intergenic
1079362605 11:19781621-19781643 AAAAGAGGTCAGTGGGTTAAAGG + Intronic
1079815632 11:25053686-25053708 AAAAGACAGCAATTGGTGAATGG - Intronic
1079910340 11:26301817-26301839 AGATGACATCAATGGGGGCAGGG - Intergenic
1080941433 11:36922424-36922446 AAATGACAACAGTGGTTAAAAGG - Intergenic
1081727178 11:45338554-45338576 AGATGACCTCAATGGGTCACTGG + Intergenic
1082116741 11:48337299-48337321 AAAGGACATCAATGGCTAATAGG - Intergenic
1082199255 11:49343552-49343574 AAATTACATGTATGGGTTTAGGG + Intergenic
1083556830 11:63636239-63636261 AAAGGAGATCAATGGCTCAAAGG - Exonic
1083916440 11:65747418-65747440 AATATACATCAATGGGTGAATGG - Intergenic
1085892730 11:80600152-80600174 AAATGTCATCACTCTGTTAAAGG - Intergenic
1086656564 11:89364560-89364582 AAATTACATGTATGGGTTTAGGG - Intronic
1087119760 11:94561003-94561025 AAATGACATCACTGGGTCATTGG + Intronic
1087871473 11:103298470-103298492 AAATGACATTCAAGGTTTAATGG + Intronic
1088336659 11:108712594-108712616 GAATGACATCAATGATATAAGGG - Intronic
1088381758 11:109200800-109200822 AAATGACATCAGTGAGCTATGGG - Intergenic
1091318554 11:134633205-134633227 AAATGAAATGAATAGGTGAACGG - Intergenic
1092599666 12:10045725-10045747 AAATGACATCAAAGGAAGAAAGG - Intronic
1092808021 12:12245195-12245217 AAATGTCATCAACAGGCTAATGG + Intronic
1092937526 12:13377946-13377968 GAATGACATCATAGGGTTAACGG + Intronic
1094864544 12:34514979-34515001 AAATGAAAACAAAGGTTTAATGG + Intergenic
1095194205 12:39294043-39294065 AAACTACATGAATGAGTTAATGG + Intronic
1095390799 12:41704171-41704193 AAAGTACATCAATGGATAAATGG - Intergenic
1095695658 12:45141486-45141508 AAATCAAATCAATAGGTTCAAGG - Intergenic
1096213847 12:49787934-49787956 AAATGCCAGCAATGGATGAATGG - Intergenic
1097601600 12:61699524-61699546 CAATGACATCAGTGGGTTGGAGG - Intergenic
1097802610 12:63931363-63931385 AAATGATTTCAATTGATTAATGG - Intronic
1097810814 12:64016733-64016755 AAGTGACAACCATGGGTGAACGG - Intronic
1098698274 12:73588036-73588058 AAATGAGGTTAATGGGTTATAGG - Intergenic
1099021317 12:77408065-77408087 CAATGACAACAATGGAATAACGG - Intergenic
1099112897 12:78585132-78585154 AAATAACTTTAATGGGATAAAGG + Intergenic
1101449159 12:104760706-104760728 ACATGACATCAATAGGTTTCTGG + Exonic
1101639210 12:106574382-106574404 AAATGACAACAATGTCATAAGGG + Intronic
1102725103 12:115056338-115056360 AAGTGCCATCAATGGGTGAATGG - Intergenic
1103990797 12:124797972-124797994 AAATGAAATCAGTGTGTCAAAGG + Intronic
1105860792 13:24410468-24410490 AAATGTCATCAGTGGATGAATGG - Intergenic
1105922784 13:24981464-24981486 AAATGTCATCAGTGGATGAATGG + Intergenic
1106454753 13:29917328-29917350 AAATTACATTAGTGGCTTAAAGG - Intergenic
1107149864 13:37098677-37098699 AAATGACATGAATGAGATGATGG - Intergenic
1107437596 13:40393971-40393993 AAATGCCATCCATGGGCTGAGGG + Intergenic
1107488277 13:40853456-40853478 AAATGCTATCAATGGATGAATGG + Intergenic
1107549620 13:41462669-41462691 AAATGACAGCAATGTGTTGCTGG - Intronic
1108193258 13:47964864-47964886 AAATGTCATCACTGGGTGAAGGG + Intronic
1109582015 13:64352463-64352485 AAATGCCATCTATGGGTTGATGG + Intergenic
1109604074 13:64669034-64669056 AAAAGACATCAATTGGACAAAGG - Intergenic
1110233291 13:73189649-73189671 AAATGGGATGAATGGGTTGATGG - Intergenic
1112252789 13:97798821-97798843 AAATGATAACCATGGGTCAAAGG + Intergenic
1113831629 13:113300110-113300132 TGCTGACATCAATGGTTTAAAGG - Intronic
1114160083 14:20155652-20155674 AAATGCCATCAATGGGAGACTGG - Intergenic
1115001337 14:28423195-28423217 GAATGACAACAATGGATGAAAGG + Intergenic
1115001859 14:28431528-28431550 AAATGATAACAATGAGTAAAGGG - Intergenic
1115109833 14:29808202-29808224 AAATGACAACAAAGGATTTAGGG - Intronic
1115492526 14:33971984-33972006 AAGTGAAATCACTGGGTTAAAGG + Intronic
1117116892 14:52523141-52523163 TACTGACAAAAATGGGTTAAAGG + Intronic
1117749701 14:58908377-58908399 AAGTGCCATCAATGGTTGAATGG + Intergenic
1117848647 14:59942234-59942256 AAATGCCATCAACAGGTGAATGG - Intronic
1121400856 14:93675812-93675834 AAATGACAGCAATGGATGCAGGG + Intronic
1121500377 14:94431230-94431252 AAACCACATCAATAGGTGAATGG - Intergenic
1121742924 14:96266630-96266652 AAGTGAGATCAGTGTGTTAAAGG + Intronic
1125906350 15:43396383-43396405 AATGGACATCAGTGGGTCAAGGG - Intronic
1127401562 15:58591956-58591978 AAAAGACAACGATGGGTTAAAGG - Exonic
1128952476 15:71900668-71900690 AAATAACACTAATGGGTTTAAGG + Intronic
1129071924 15:72958812-72958834 AAGTGAGATCACTGGGTCAAAGG + Intergenic
1131370866 15:91880753-91880775 AAATGCCATCAAGAGGTGAACGG - Intronic
1131467266 15:92665843-92665865 GCATGACATCAAGGGGATAAGGG - Intronic
1131488607 15:92842798-92842820 AATTGGCATCAATGTGTGAAGGG - Intergenic
1131565370 15:93480571-93480593 AACAAACATCAAAGGGTTAAAGG - Intergenic
1131696651 15:94883752-94883774 ATATGACATCTTTGGGGTAACGG - Intergenic
1133626674 16:7576224-7576246 AAAGGACATTAATGGGGTAATGG - Intronic
1134739849 16:16532962-16532984 AAATGACATAGATGGGTAAATGG - Intergenic
1134927650 16:18179202-18179224 AAATGACATAGATGGGTAAATGG + Intergenic
1135298683 16:21305397-21305419 AAATGACATCAATGGTTATAGGG - Intergenic
1135510377 16:23077821-23077843 AAATGGAATCATTGGGCTAAGGG - Intronic
1135714043 16:24745647-24745669 AAATGACAATAATGGGACAAGGG - Intronic
1136066976 16:27765986-27766008 AAATGGGATCACTGGGCTAAAGG + Intronic
1138377574 16:56576465-56576487 AAATCACATTTATGGGTAAATGG - Intergenic
1139932325 16:70538216-70538238 AAATGACATTAAAGGCCTAAAGG - Intronic
1141129779 16:81428276-81428298 AAAAGACATTTATGGGATAATGG - Intergenic
1144098864 17:11926147-11926169 CAATGATATCAATAGGCTAATGG + Intronic
1144396694 17:14850930-14850952 AAATGACAGAGTTGGGTTAAGGG + Intergenic
1145929363 17:28673896-28673918 AAATGACTTCAAAGGGGTAAAGG + Intronic
1147340302 17:39749853-39749875 AAATGAAATCCAGAGGTTAAAGG + Intergenic
1148349674 17:46931424-46931446 AAATGACACCAAAGAGGTAAGGG - Intronic
1148536431 17:48442817-48442839 AAATGACATCACTGGTTTTAGGG - Intergenic
1149159443 17:53673025-53673047 AAAGGACATCAAAAGGATAATGG + Intergenic
1150167731 17:62960423-62960445 AAAAGACATCAGTTGGTAAAAGG + Intergenic
1150178240 17:63085621-63085643 AAATGACAACAATGATATAAGGG - Intronic
1150672412 17:67212852-67212874 AAATGAGATTAGTGGGTCAAAGG + Intronic
1151126544 17:71851616-71851638 CAATGACACCAATGTGCTAAAGG - Intergenic
1155742212 18:29302620-29302642 AAATGAGATCACTGGGTCAATGG - Intergenic
1156980252 18:43278179-43278201 AAATGACATTTATGGTTAAAAGG + Intergenic
1159242787 18:65764307-65764329 AAAGGACATTAATAAGTTAAAGG + Intronic
1159264343 18:66060766-66060788 AAATGTCATCAATTGGTGAATGG + Intergenic
1159826580 18:73219909-73219931 ATGTGACATCAATAGGTTATGGG + Intronic
1162894782 19:13758770-13758792 AAATGACACCATTGGGTGGAAGG + Intronic
1163341354 19:16709451-16709473 AAATGACATCAATAGGAGATTGG - Intergenic
1163349929 19:16770122-16770144 AAACCATATCAATGTGTTAAAGG - Intronic
1165645086 19:37428990-37429012 TAATGAAATGAATAGGTTAAAGG + Intronic
925269103 2:2589701-2589723 AAATGAAAACAATAGGGTAACGG - Intergenic
926011789 2:9414317-9414339 AAATGATGTGAATGGGTTAGAGG - Intronic
928265780 2:29810458-29810480 AAATGTTATCAATGAGATAATGG + Intronic
930474859 2:51868923-51868945 AAATGCAATAAATGTGTTAAAGG + Intergenic
930507525 2:52303164-52303186 AAATGCCATCAACAGGTGAAAGG - Intergenic
930744962 2:54872867-54872889 CAATGACAACAAAGGGCTAAGGG - Intronic
931752512 2:65342971-65342993 AAATTACATCAAAGGGCTAAGGG + Intronic
933286077 2:80385976-80385998 AAATAACATGGATGGGTTGATGG + Intronic
933883490 2:86695703-86695725 AAAGTGCATCAATAGGTTAATGG + Intronic
934091036 2:88550496-88550518 AAGTGACAACTATGAGTTAAAGG - Intergenic
935167708 2:100583826-100583848 TAGTGTCATCAATGGCTTAAGGG + Intergenic
935431010 2:102975735-102975757 AAAAGACAACAATGCTTTAAAGG + Intergenic
935535000 2:104283689-104283711 ATATGACATCAATTGGTGAGGGG + Intergenic
936675876 2:114713341-114713363 AAATAAAATGACTGGGTTAAAGG + Intronic
938322806 2:130376449-130376471 TAAAGACATCATTGGGTTTAGGG - Intergenic
938918515 2:135969120-135969142 AAATGAAATTGCTGGGTTAAAGG - Intronic
939108917 2:137983333-137983355 AAATTACAACAATGGTATAATGG - Intronic
939138695 2:138326858-138326880 TAATCACATCAATAGGATAAAGG + Intergenic
939321767 2:140632339-140632361 GAATGACAGCAATGTTTTAAGGG + Intronic
939779562 2:146428966-146428988 AAATGACTCCAAAGGATTAAAGG + Intergenic
940010677 2:149051633-149051655 AAATGACATAAGTGAGTAAAGGG + Intronic
940492898 2:154387899-154387921 AAATGAAATCAATATGTCAAAGG - Intronic
940852359 2:158700812-158700834 TAATGTCATCAGTGGGTTCATGG - Intergenic
941841863 2:170094232-170094254 AATTAACATCAATGGGTTACTGG + Intergenic
942625260 2:177893575-177893597 GATTGATATCAAGGGGTTAAGGG - Intronic
944485296 2:200199298-200199320 AACTGAAATCAATGTGTCAAAGG + Intergenic
945026295 2:205623034-205623056 TAATGTCCTCAATGGGTTACCGG - Intergenic
945393227 2:209290437-209290459 AATTGACATCAAAGACTTAATGG - Intergenic
945700410 2:213162373-213162395 AAATGACCTCATTGACTTAAAGG - Intergenic
945748254 2:213746190-213746212 AAAAGACTTCAGTGGCTTAATGG - Intronic
947086909 2:226463598-226463620 AAATGTCATCAACAGGTGAATGG + Intergenic
947265575 2:228275860-228275882 AAATGTCATCAATGGTGGAATGG - Intergenic
1168838836 20:895669-895691 AATGGACATCAATTGGTGAATGG + Intronic
1169321743 20:4638502-4638524 TAATGACATAAATTGGTCAATGG - Intergenic
1169360070 20:4940843-4940865 AACTGACTTCAACAGGTTAAAGG + Intronic
1170151604 20:13232533-13232555 AAATAACCTAAATGGGTCAATGG - Intronic
1170722156 20:18891266-18891288 AAATGAGAGCAATGGTATAAAGG + Intergenic
1171160697 20:22920214-22920236 AAATGAAATGAATTGTTTAATGG - Intergenic
1173418050 20:42876081-42876103 AAAACACATCAATATGTTAATGG + Intronic
1174884337 20:54315756-54315778 AAATGATTTTACTGGGTTAAAGG - Intergenic
1175656881 20:60778810-60778832 AAAGGACATCATTGGATTTAGGG - Intergenic
1176738920 21:10579770-10579792 AAATGTCATCAGTGGATGAATGG - Intronic
1177168127 21:17626008-17626030 AAATGTCAAAAATGGGCTAATGG - Intergenic
1177664321 21:24133840-24133862 AAATTAGATCAGTGAGTTAATGG + Intergenic
1178762401 21:35415804-35415826 AAAGGACATTACTGGGTCAACGG + Intronic
1179364867 21:40749738-40749760 AAATGAAATCAGTGTGTTGAAGG + Intronic
1180097690 21:45566637-45566659 AAATGACAGCAATGTGGTAAGGG - Intergenic
1182422866 22:30257056-30257078 AAAGAGCATCAAAGGGTTAAAGG - Intergenic
1182811522 22:33121083-33121105 AAAGGACATCAATGGCTAACAGG - Intergenic
1182837381 22:33354522-33354544 TAATGTCATCGATAGGTTAACGG - Intronic
1183853560 22:40613229-40613251 AAATGCCATCAACAGGTGAATGG - Intronic
950031864 3:9858977-9858999 AAATGATATCAATTGGCAAAAGG - Intergenic
951065647 3:18262082-18262104 AAATGGGATCACTGGGTCAAAGG - Intronic
951134232 3:19084320-19084342 AAATGATAACAATGAGATAAAGG + Intergenic
952248606 3:31626549-31626571 AAAAGACTTCAATAGATTAAGGG + Intronic
952438728 3:33300631-33300653 AAATGACAGAAATGATTTAAAGG - Intronic
952586201 3:34895439-34895461 TAATGCCATCAAAGGATTAAAGG + Intergenic
953231905 3:41072844-41072866 AAATGAGATAAATGTGTAAAGGG - Intergenic
954609344 3:51936099-51936121 AAAATACATAAATGGGCTAAAGG - Intronic
954818316 3:53302201-53302223 AAATGTTATCAATGGGCAAATGG + Intronic
956136019 3:66099749-66099771 AAATCACCTCAATGGATTCATGG - Intergenic
956930627 3:74039107-74039129 AAATGACATAAAGGGCTTGAGGG - Intergenic
957866302 3:86028341-86028363 AAAACACAAAAATGGGTTAAGGG + Intronic
958048778 3:88318818-88318840 AGATGCCATCAATGGGTTTCAGG + Intergenic
959543030 3:107562010-107562032 AAATGAAATCCATGGCTAAAAGG - Intronic
959800057 3:110482710-110482732 AAATGACTTGAAGGAGTTAAAGG + Intergenic
961783920 3:129337994-129338016 AAATGATATCAATTGGCAAAAGG - Intergenic
961926309 3:130485037-130485059 AAATGAAATTACTGTGTTAATGG + Intergenic
962069586 3:132019654-132019676 AAGTGGCATCATTGGGTCAAGGG - Intronic
963680477 3:148369191-148369213 AAATGAGATCCATATGTTAAAGG + Intergenic
965028056 3:163328156-163328178 AAATGACAACAGAGGTTTAAAGG + Intergenic
965331451 3:167379848-167379870 AAATGACTTCAAAGGATAAAAGG + Intronic
966061957 3:175768477-175768499 AAATTACATAAACTGGTTAAGGG + Intronic
966920290 3:184606707-184606729 AAATGACATCAATGGGTTAATGG + Intronic
966983894 3:185162397-185162419 AAATAACATCAAGGAGTGAAGGG + Intergenic
967149288 3:186633530-186633552 AAATGGAATCACTGGGTCAAGGG - Intergenic
967783529 3:193465527-193465549 AAATGATATCAGTGGGTTAAAGG + Intronic
970739460 4:19217426-19217448 AAATGAAATTAATAGGTAAAAGG + Intergenic
970943512 4:21663236-21663258 AAATGTCATCAAATGGTTAATGG + Intronic
971323174 4:25621820-25621842 ATAAGTCAGCAATGGGTTAAGGG - Intergenic
972175501 4:36400540-36400562 AAATGACATCAATGATACAAGGG - Intergenic
972402566 4:38719066-38719088 TAATGTCATCAATAGGTTATTGG - Intergenic
972444947 4:39135181-39135203 AGAAGACATCCATGGGTTGAAGG + Intergenic
973300253 4:48574072-48574094 AAATTAAATTAATGGGTCAAAGG + Intronic
974510101 4:62828463-62828485 AGATGTCTTCAATGGGTGAATGG - Intergenic
974989597 4:69069176-69069198 ACATTACATCAATGGATTCATGG - Intronic
975598162 4:76070057-76070079 AAATGTCATCAACTGGTAAATGG - Intronic
976623366 4:87152107-87152129 AAAACACATCAATGTGCTAAGGG + Intergenic
976632374 4:87252429-87252451 AAATTAAATCAATGTGTAAATGG - Intergenic
976852555 4:89564887-89564909 AAATGTCATCAACTGGTAAATGG - Intergenic
978264065 4:106801175-106801197 AAATGGCATAAGTGAGTTAATGG + Intergenic
978307365 4:107345408-107345430 AAAAGACTTCAAAGGGTAAAGGG + Intergenic
978511478 4:109523750-109523772 AAGTGAAATTATTGGGTTAAAGG + Intronic
978530373 4:109706493-109706515 AAATGACAACAAAGGATTCAGGG + Intergenic
979316075 4:119264894-119264916 AAATGTCAGCAATTGGTGAATGG + Intronic
980736557 4:136897540-136897562 AAATGCCATCAATGTATGAATGG - Intergenic
980864365 4:138537012-138537034 AAAGGAAATCAATGTGTCAAAGG + Intergenic
981642793 4:146964841-146964863 AAATGAAAACAAAGGGTTTATGG + Intergenic
981818536 4:148859362-148859384 AAAAATCAGCAATGGGTTAATGG + Intergenic
982372086 4:154644984-154645006 AAATCAAATTAATGTGTTAAAGG + Intronic
982802802 4:159724907-159724929 AAATGACATGCATGAGTTAGAGG - Intergenic
982873035 4:160608027-160608049 AAATGACAAAAACAGGTTAAAGG - Intergenic
983534918 4:168847181-168847203 AAATGAGATTATTGGGTCAAAGG - Intronic
985219303 4:187685683-187685705 AAATGTCTTCAATGGTTGAAGGG - Intergenic
986192147 5:5507551-5507573 GAATGACATCACTGGGTCATAGG - Intergenic
990052070 5:51515375-51515397 ATATAACATCAATAAGTTAAGGG - Intergenic
990271203 5:54141960-54141982 AAATGTCATCAATTGGTGAATGG - Intronic
990505694 5:56442438-56442460 AAATGAAATTTATGGGTTAAAGG + Intergenic
990525838 5:56626602-56626624 AAATGACATCAATGGCAGAGTGG - Intergenic
990759322 5:59110972-59110994 CAATGTCATAAATTGGTTAAAGG - Intronic
993278444 5:85893229-85893251 AAATGACAGCCTTGGGTAAAAGG - Intergenic
994024466 5:95066513-95066535 AAATGAAATCAGTGTGTCAAAGG + Intronic
994816717 5:104595075-104595097 AAAGGACATCAATCAGATAAAGG + Intergenic
994898395 5:105736629-105736651 AAGTGTCTTCAATGGGTTCATGG + Intergenic
997053622 5:130413359-130413381 AGATGAGATAAAAGGGTTAAGGG - Intergenic
997871565 5:137510111-137510133 AAAATACATCAATGGGAAAATGG + Intronic
998981566 5:147709140-147709162 AAATGACATAAATAGATTTACGG + Intronic
999567419 5:152880299-152880321 AAATGACATTATTGGGTCAGTGG + Intergenic
1003748476 6:9028999-9029021 TAATGACAGCAATGCCTTAAGGG - Intergenic
1008511513 6:52279986-52280008 AAATGCCATCAATAGTGTAATGG + Intronic
1008632676 6:53378648-53378670 AAATGGAATCATTGAGTTAATGG + Intergenic
1008793625 6:55272110-55272132 AAATGTTATCAATGAGTAAATGG + Intronic
1010280218 6:74014539-74014561 AAATGAGACTATTGGGTTAAAGG + Intergenic
1010337520 6:74704310-74704332 AAAGGACATCAAGGGGTTAAGGG + Intergenic
1010681153 6:78800884-78800906 AAATGACATCATTGGGATTCAGG - Intergenic
1011292269 6:85789234-85789256 AAACCATATCAATGGGTTAATGG - Intergenic
1011501010 6:87989878-87989900 AAATGAAATCAATATGTTGAAGG + Intergenic
1011886275 6:92099748-92099770 AGAGGACATTAATGGGTAAAAGG - Intergenic
1012425151 6:99105926-99105948 AAATGAAATCAGTGTGTTGAAGG + Intergenic
1012544243 6:100398665-100398687 AAGTGTCATCAATGGGTGAATGG - Intronic
1012551977 6:100471357-100471379 AAATGTCCTCAGTGGGTGAAAGG - Intergenic
1013750977 6:113405915-113405937 GAATGCCATCACTGGGTTATGGG - Intergenic
1013910075 6:115264991-115265013 AAATGACAACAATGTCTCAAGGG - Intergenic
1015013368 6:128378437-128378459 AAATGACATCAAAAGATTGATGG + Intronic
1015676870 6:135760694-135760716 AAATGTCATTAATGGGTGAATGG - Intergenic
1016381333 6:143484687-143484709 ACATGAAATCACTGGGTCAAAGG - Intronic
1017358268 6:153536010-153536032 CAGAGAAATCAATGGGTTAAAGG - Intergenic
1018536301 6:164823836-164823858 ATATGAGATTAATGGGTCAAAGG + Intergenic
1019983244 7:4637333-4637355 AAGTGACATTAATGGCCTAATGG + Intergenic
1021002926 7:15355907-15355929 AAAAGAAAACAATGGGTAAAAGG + Intronic
1022077533 7:26987435-26987457 AGATCACATCAAAGGGTGAAAGG + Intronic
1023449330 7:40266062-40266084 AAATGACAGAAATGGTTTAGTGG - Intronic
1026298171 7:69074278-69074300 AAATGCGATCAATTGGGTAACGG + Intergenic
1028345611 7:89778588-89778610 AAATTACATAAATGGATCAAGGG - Intergenic
1028396760 7:90378307-90378329 AACTGACATCAAAGCTTTAAAGG - Intronic
1028423091 7:90655223-90655245 ATGTTACATCAATGGGTAAATGG - Intronic
1029798143 7:102916923-102916945 AAATGACTTCAATTCTTTAATGG - Intronic
1030969534 7:116038141-116038163 AAATTACATTAATGCCTTAAAGG - Intronic
1031086022 7:117302664-117302686 AAATGACATCAGTAGGAAAATGG + Intronic
1031203540 7:118723448-118723470 AAAGCATATCAATAGGTTAAGGG - Intergenic
1032214287 7:129945090-129945112 AAATGAGATCAATGGTTGGAAGG + Intronic
1032280741 7:130498947-130498969 TAATGTCATCAATGGGTTCTTGG + Intronic
1033401682 7:141031997-141032019 AAATGTTATCACTGGTTTAAAGG + Intergenic
1034077724 7:148248767-148248789 GAATGAAATCAATGAGTTTATGG + Intronic
1035091017 7:156310400-156310422 AAGTGTCATCAATGGATGAATGG - Intergenic
1035794937 8:2347054-2347076 AAAGGACATTAATTGGTTTATGG - Intergenic
1037052394 8:14392419-14392441 AAATGATATGAATGAGTTTAAGG + Intronic
1037353703 8:17994510-17994532 AAAAGACATCAGTGTATTAAAGG - Intronic
1039401489 8:37273649-37273671 AACTGACAGAAATGGGTTGAAGG + Intergenic
1039530343 8:38255855-38255877 AATTGAAATCAATGGCATAAAGG + Intronic
1039745918 8:40426665-40426687 ACATGTCTTCAATGGGTGAATGG - Intergenic
1040940117 8:52824378-52824400 GAATGTCATCAATGGGTTCTTGG - Intergenic
1041339442 8:56826999-56827021 GAATGACATCAATGACATAAGGG + Intergenic
1042939628 8:74094415-74094437 AAATATCATCAATTTGTTAAAGG - Intergenic
1043224265 8:77702785-77702807 AAATGAAATCAATATGTTGAAGG - Intergenic
1043817512 8:84820093-84820115 AAATGACATCAAATTGTTACTGG - Intronic
1044720425 8:95140207-95140229 AGATGACTTCAAAGGCTTAAGGG - Intronic
1045057289 8:98380375-98380397 AGATGACATCAAAGTGTTATCGG - Intergenic
1045461869 8:102432387-102432409 AAATCAAATCAATGCGTTAAAGG + Intergenic
1045784528 8:105904833-105904855 AAATGACAGCAAGGGACTAAGGG - Intergenic
1046546038 8:115651272-115651294 AAATGACATTAATCGATAAAAGG + Intronic
1046875555 8:119250991-119251013 AAATCCCATCAATGGATGAATGG + Intergenic
1047559681 8:125973111-125973133 AAATGACATTAATCCATTAATGG + Intergenic
1048311931 8:133329579-133329601 AAATGAGATCGATGGCTCAAAGG + Intergenic
1048369207 8:133762965-133762987 AAATGATAACATTGGATTAATGG + Intergenic
1049033566 8:140056469-140056491 ATATGAGATCAATGGAATAAAGG + Intronic
1050099438 9:2102806-2102828 AAAAGTCATCAATGGGTTTTAGG - Intronic
1050898888 9:10919697-10919719 AAATCACATCAATGATTTTATGG + Intergenic
1050910573 9:11064421-11064443 AAATGTCATCAACTGGTGAATGG - Intergenic
1050992404 9:12170827-12170849 AAAGGACACCAATGGCTAAATGG - Intergenic
1051040214 9:12800162-12800184 AATTGACATAAATAGGTCAAAGG - Intronic
1053522699 9:38797053-38797075 ATATGACATTAATAGGATAAAGG - Intergenic
1054194924 9:62021473-62021495 ATATGACATTAATAGGATAAAGG - Intergenic
1054643484 9:67567217-67567239 ATATGACATTAATAGGATAAAGG + Intergenic
1055185561 9:73448821-73448843 ATGTTACATCAATTGGTTAATGG - Intergenic
1055191435 9:73529628-73529650 AGATGGCATCAATGGTTTCAAGG - Intergenic
1055601988 9:77929257-77929279 TAATGAAATCAATGGGTTCAGGG - Intronic
1056816329 9:89803852-89803874 AAATGAAAGCAATGGGTTCAGGG - Intergenic
1058169499 9:101663173-101663195 GAATGAGATAAATGAGTTAAAGG - Intronic
1058205838 9:102105767-102105789 AAATGAAATAAGTGTGTTAAAGG + Intergenic
1058245525 9:102619803-102619825 AAAAGACATCAAATGGTTAGAGG + Intergenic
1058862925 9:109134989-109135011 AAATGACATCAAGTGCATAATGG - Exonic
1058929457 9:109704650-109704672 AAATGACACCAACAGGTGAAAGG - Intronic
1060228519 9:121810720-121810742 AACTGGAATCAATGGGTCAAAGG - Intergenic
1060494789 9:124110653-124110675 AAACCATATCAATGGGGTAAAGG - Intergenic
1185954928 X:4478743-4478765 AAATGACAGCAATTAGATAACGG + Intergenic
1187378048 X:18775197-18775219 AAAAAAAAGCAATGGGTTAAAGG - Intronic
1190763133 X:53453217-53453239 AAATGAAATTGCTGGGTTAAGGG + Intergenic
1191081766 X:56519249-56519271 ATATGACACCATTGGGTAAAGGG - Intergenic
1191693938 X:63968856-63968878 GAATGACATCAATGTTATAAGGG + Intergenic
1193667590 X:84341270-84341292 CAATGACAGAAATGGTTTAAAGG + Intronic
1195215998 X:102703315-102703337 AAATGACAACAATGGTATAAAGG + Intergenic
1195765223 X:108289150-108289172 TAAGGACATCATTGGGATAACGG + Intronic
1195903627 X:109823316-109823338 AAAATACATCACTGGGCTAAAGG + Intergenic
1196888190 X:120267068-120267090 CTCTGGCATCAATGGGTTAATGG + Intronic
1197162738 X:123342332-123342354 AAGTGACCTCAATTGGGTAATGG - Intronic
1197740851 X:129892572-129892594 AAATTCCATCAATGGATGAATGG + Intergenic
1198543223 X:137662592-137662614 AAATGAAATCAGTGTGTTGATGG - Intergenic
1200052051 X:153438603-153438625 AAATGACACCCATGGGTCACTGG - Intergenic
1200841765 Y:7788919-7788941 AAATGAAATCAGTATGTTAAAGG - Intergenic
1201396267 Y:13552475-13552497 AAATGAAAGCAAAGAGTTAAAGG - Intergenic
1202597655 Y:26559304-26559326 AAATGTCATCAGTGGATGAATGG - Intergenic