ID: 966920398

View in Genome Browser
Species Human (GRCh38)
Location 3:184607458-184607480
Sequence CCGCACTTCCCCCGTCCCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 85}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966920391_966920398 17 Left 966920391 3:184607418-184607440 CCAAACTAAGCTTAGCAAAGGTG 0: 1
1: 0
2: 0
3: 10
4: 120
Right 966920398 3:184607458-184607480 CCGCACTTCCCCCGTCCCATAGG 0: 1
1: 0
2: 1
3: 3
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966920398 Original CRISPR CCGCACTTCCCCCGTCCCAT AGG Intronic
900195957 1:1375495-1375517 CCGCACTTCCGTCGGCCCGTTGG - Intronic
903384566 1:22917971-22917993 CTTCACTTCCCCCGTTCCACTGG - Intergenic
916662065 1:166931735-166931757 CCCCACTTCCCTCATCCAATTGG - Intronic
1063580498 10:7301945-7301967 CCACACCTCCCCTGTCCCTTGGG - Intronic
1063976766 10:11423681-11423703 CCGCACTTACCCAGGCCCAAGGG + Intergenic
1066388412 10:34959982-34960004 CCTCACTTCCCCTTTCCCAAGGG - Intergenic
1075655474 10:124158297-124158319 CCGCAATTCCCACGTGTCATGGG - Intergenic
1081593586 11:44444181-44444203 TGTCACTTCCCCCGTGCCATGGG + Intergenic
1081990882 11:47336951-47336973 CAGCCCTTGCCCCATCCCATAGG + Intronic
1082627292 11:55501204-55501226 CGGCTCTTCCCGCGTCCCAGTGG + Intergenic
1084577282 11:69997529-69997551 CCACTCTCCCCCCGTCCCAACGG + Intergenic
1089118204 11:116113124-116113146 CCGCTCTTCCCCCATCCCATGGG + Intergenic
1090493614 11:127188450-127188472 CCACTCTGCCCCCGCCCCATAGG - Intergenic
1092265747 12:6979084-6979106 CAGCACTTCCCCCCTTCCCTTGG + Intronic
1105913766 13:24894256-24894278 CCGCTCTTACCCCGTCCCTGTGG - Intronic
1108550882 13:51542611-51542633 CTCCACTTCCCCCGACCCCTGGG + Intergenic
1116862103 14:50003231-50003253 CCGCACTTGCCCGTTGCCATGGG - Intronic
1119173695 14:72553885-72553907 CCGCCCATCCTCTGTCCCATGGG + Intronic
1119759664 14:77141561-77141583 CCGCACTGCCGCCGTCGCAGAGG + Intronic
1122601070 14:102922299-102922321 ACGCAGTGCCCCTGTCCCATGGG - Intergenic
1122883622 14:104700891-104700913 GGGCACTTCCCCCGCCCCAGTGG - Intronic
1124925637 15:34067707-34067729 CCCCACCTCCCTTGTCCCATAGG - Intergenic
1125573506 15:40739136-40739158 CCCCACATCCCCCCTCCCAAAGG + Intronic
1127346595 15:58107269-58107291 CTGGACTTCCCCTGTCCCCTAGG + Intronic
1127631203 15:60829029-60829051 CATCACTCCCCCCGACCCATGGG - Intronic
1128470857 15:67951310-67951332 CCACAATTCCCACGTCTCATGGG + Intergenic
1128783555 15:70378700-70378722 CCTCTCTGCCCCCGGCCCATGGG - Intergenic
1130086807 15:80784481-80784503 CTGCACTTTCCTCGTCCCAAGGG - Intronic
1132882695 16:2169537-2169559 CTGCCCTTCCCCCGTCCCCCAGG + Intronic
1133383132 16:5347762-5347784 CCACACTTCCACCCACCCATTGG + Intergenic
1137311906 16:47270892-47270914 CAGCACTTTCCCCATCCCACAGG - Intronic
1139526726 16:67521330-67521352 TGGAAATTCCCCCGTCCCATCGG - Intronic
1142479981 17:213322-213344 GCGCAGTGCCCCCCTCCCATGGG - Exonic
1147966921 17:44199022-44199044 CGGCTCTTCCCCCGTCCCTGCGG + Intronic
1151965176 17:77427473-77427495 CCTCACTTCCCCCGTCCTCCGGG + Intronic
1152492761 17:80648793-80648815 CCACAATTCCCACGTGCCATAGG + Intronic
1152593801 17:81228536-81228558 CCACTGCTCCCCCGTCCCATCGG - Exonic
1154144715 18:11857510-11857532 CTGCGCTTCCTCCTTCCCATGGG - Intronic
1160662464 19:307400-307422 CCGCTGTACCCCTGTCCCATCGG - Exonic
1161579350 19:5072178-5072200 GCTCTCTTCCCCCTTCCCATGGG + Intronic
1162782457 19:13013362-13013384 CCGCCCGTCCCCAGTCCCCTCGG + Intronic
1162909730 19:13842499-13842521 CCGCCCTTCCCCCGCTCCGTAGG + Intergenic
925562942 2:5217930-5217952 CCACAATTCCCACATCCCATGGG + Intergenic
928463979 2:31502760-31502782 CCACAATTCCCCCGTGTCATGGG - Intergenic
932565952 2:72909493-72909515 TCACACTTCCTCCCTCCCATAGG + Intergenic
934097525 2:88620284-88620306 CCACACTCCCCCCTTTCCATGGG + Intronic
942276709 2:174328417-174328439 ACGCACTTCACCCGTCCCAGAGG - Intergenic
944820913 2:203429866-203429888 CTGCACTGCCCCCATCCCGTAGG - Exonic
1170940997 20:20847984-20848006 CTGGACTTCCCCAGCCCCATCGG - Intergenic
1172776298 20:37409202-37409224 CCTCACTTCCCCTGTCCCAGAGG + Intergenic
1172794666 20:37528375-37528397 CCCCACTTGCCCCGTACCTTGGG + Intergenic
1172863823 20:38079127-38079149 CCAAGCTTCCCCCGTGCCATAGG + Intronic
1174761977 20:53215535-53215557 CCTCACTTCTCCCCTCCCAAAGG - Intronic
1175858451 20:62135519-62135541 CCGCACTTCACCCGACCAATTGG - Intergenic
1177194941 21:17894292-17894314 CCTCACTTCACCAGTCCCAGTGG + Intergenic
1178371201 21:32028903-32028925 CAGCACTGGCCCCGTCCCTTTGG + Intronic
1180559038 22:16601322-16601344 CCGCCCCTCCCCCTCCCCATGGG - Intergenic
1183328954 22:37209145-37209167 CTGCACTTCCTCCCTCCAATGGG + Intronic
966920398 3:184607458-184607480 CCGCACTTCCCCCGTCCCATAGG + Intronic
968640456 4:1712069-1712091 CCGCACAACCCCCGCCCCACGGG + Intronic
969436226 4:7191243-7191265 CCTCCCTTCCCTCTTCCCATTGG + Intergenic
974016755 4:56655662-56655684 CCCCGCTTCCCCGCTCCCATGGG - Intronic
978614005 4:110575419-110575441 CCTCACTTCCCCTATCCTATAGG - Intergenic
979539947 4:121870076-121870098 CCGCTTTTCCCCGGTCCCCTCGG + Intronic
985531885 5:438661-438683 GGGCCCTTCCCCCTTCCCATGGG - Intergenic
985618053 5:936485-936507 TCCCAGTTCCCCAGTCCCATGGG - Intergenic
987939570 5:24515775-24515797 CCGCAATTCCCACGTGTCATGGG + Intronic
988180573 5:27786455-27786477 CCAGACTTCCCCTATCCCATTGG - Intergenic
989229982 5:39074465-39074487 CGGCACCTCCCCCGCCCCCTCGG + Intergenic
995989826 5:118223931-118223953 CCCCACTTCCCTCGACACATAGG + Intergenic
996738524 5:126778114-126778136 GCGCACTTACCACGTCCCAGCGG - Intronic
999246165 5:150155887-150155909 CCCCACTTCCCCCGCCACTTTGG + Intergenic
1001081315 5:168669746-168669768 CCCCACTTCCTCCCTCCCACAGG + Intronic
1001260273 5:170222416-170222438 CCTCCCTTCCCCCATCCCAAGGG - Intergenic
1005701000 6:28399955-28399977 CCACACTTCCCCCGACCCGATGG + Intergenic
1012232339 6:96774894-96774916 CCGCACACCCCACCTCCCATAGG - Intergenic
1022171635 7:27837421-27837443 CCACATTTCCCCGTTCCCATGGG + Intronic
1028101542 7:86826843-86826865 CTGCAATTCCCCCGCCCCCTTGG + Intronic
1028128971 7:87147715-87147737 ACGCACTTCCTCCCACCCATGGG - Intergenic
1029224280 7:99013823-99013845 CCGTGCTGCCCCCGTCCCCTGGG - Intergenic
1034155471 7:148952879-148952901 CCCCACTTCCCCCGACCCCATGG + Intergenic
1038607128 8:29018671-29018693 CCATACTTCCCTAGTCCCATAGG + Intronic
1042495806 8:69453513-69453535 CTGCACTTCTCCCATCACATTGG + Intergenic
1044813691 8:96089393-96089415 CCCCACTTCCCTCTGCCCATAGG + Intergenic
1061941572 9:133886950-133886972 CAGGACTTTCCCAGTCCCATGGG + Intronic
1062396507 9:136354979-136355001 CCGGACTTCTCCCCTCTCATGGG - Intronic
1062621071 9:137422938-137422960 ACGCACCTTCCCCGCCCCATCGG + Intronic
1186842584 X:13499152-13499174 TCTCACTTCCCGAGTCCCATGGG + Intergenic
1190118026 X:47638374-47638396 CCCCAAGTCCCCTGTCCCATAGG - Intronic
1196665002 X:118306321-118306343 CCACAATTCCCACGTGCCATGGG - Intergenic