ID: 966920823

View in Genome Browser
Species Human (GRCh38)
Location 3:184610418-184610440
Sequence CAGCCTCAGGAATGTTTCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966920816_966920823 -4 Left 966920816 3:184610399-184610421 CCATCTGGAGCTGAGCTCCCAGC 0: 1
1: 0
2: 3
3: 40
4: 357
Right 966920823 3:184610418-184610440 CAGCCTCAGGAATGTTTCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966920823 Original CRISPR CAGCCTCAGGAATGTTTCGG GGG Intronic
900251366 1:1671897-1671919 CAGAATCAGGAAGGTTTCTGTGG - Intronic
902620551 1:17648373-17648395 CAGCCTCAGGAGTGATGCCGTGG - Intronic
903694247 1:25195694-25195716 CAGCCTCAGGGATGTGCCGGGGG - Intergenic
904907988 1:33912415-33912437 CAGCCTCAGGAGTGTGTGTGGGG - Intronic
905229932 1:36508664-36508686 CAGCCTCCAGAATGTCCCGGGGG + Intergenic
907600794 1:55767398-55767420 CAGCTGCAGGAATGTTTCCTGGG - Intergenic
908636208 1:66168497-66168519 CTGCCTCTGGAATTTTTCAGTGG - Intronic
910012572 1:82483400-82483422 CAGCCTCAGACAGGTTTTGGTGG + Intergenic
915457666 1:156051433-156051455 CAGCCTCAGGACTGCTCAGGAGG - Intronic
920727069 1:208446044-208446066 CAGACTCAGGGCTGTTTTGGTGG - Intergenic
1073550804 10:104399440-104399462 CAGCCTCAGCAATTATTCGCAGG - Exonic
1075882647 10:125866986-125867008 CAACCTCAGGATTGTTTCGTTGG + Exonic
1079175729 11:18138258-18138280 CTGCCTCAGAAATGTCTCAGTGG + Exonic
1079263737 11:18910318-18910340 CCGCCTCAGAAATGTCTCAGTGG - Intergenic
1079265980 11:18933707-18933729 CTGCCTCAGAAATGTCTCAGTGG - Intergenic
1084757129 11:71246682-71246704 GAGCCTCAGGGATGTTAGGGAGG - Intronic
1092022730 12:5215766-5215788 CAGCCTCATTAATGATTCTGGGG + Intergenic
1092869298 12:12792060-12792082 CAGACCCAGGAATGTTTCCAAGG - Intronic
1097625183 12:61991213-61991235 CAGCCTCTGGAATTGTTGGGAGG + Intronic
1097864796 12:64550956-64550978 TAGCCTAAGGAATGTGTGGGTGG - Intergenic
1100355616 12:93826421-93826443 CAGCCTCTGGAATTTTTCCTCGG + Intronic
1101298782 12:103456056-103456078 AAGTCTCAGGAAAGTTTCTGAGG + Intronic
1103412612 12:120723356-120723378 CAGCCTCAAGAAGGATTTGGTGG + Exonic
1109721702 13:66283587-66283609 CAGCCCCAGGAATGTGTCCTGGG + Intergenic
1113036974 13:106061634-106061656 CAGCATCAGGGATGTTTTGCAGG - Intergenic
1115299209 14:31865434-31865456 CAGACTCAGGGCTGTTGCGGGGG + Intergenic
1116982596 14:51187339-51187361 TAGCTCCAGGAATGTTTTGGAGG - Intergenic
1117916066 14:60679460-60679482 CAGATTCATGAATGTTTCTGTGG - Intergenic
1120373379 14:83667933-83667955 CAGCTTAAGGAATTTTTGGGTGG - Intergenic
1121950804 14:98169657-98169679 CTACCTCATGAATGTTTCTGTGG + Intergenic
1129994161 15:79990485-79990507 CAGCATCAGGACAGTTTGGGGGG + Intergenic
1130763495 15:86845980-86846002 CAGTCTCAGGCATGTGTCGAAGG - Intronic
1131795837 15:96016007-96016029 CAGCCTCAAGAAGGATTTGGTGG - Intergenic
1136574135 16:31113243-31113265 CAGCCTCAGGAAGTTTGCTGTGG - Intergenic
1140271692 16:73472016-73472038 CAGCCTCAGAAATGAGTCCGTGG - Intergenic
1141355936 16:83347127-83347149 TGGCCTCATGAATGCTTCGGGGG - Intronic
1142126132 16:88411566-88411588 CAGCCTCAGGTGTGTTTGGAAGG + Intergenic
1142175252 16:88642310-88642332 CAGCATCAGGATGGTTTCAGGGG + Intergenic
1143553536 17:7646477-7646499 CAGCTCCATGAATGTTTGGGGGG - Intergenic
1152564983 17:81096358-81096380 CAGCCTCAGGAATGTGTGTGAGG - Intronic
1152615288 17:81335012-81335034 CAGTCTCAGGAAAGCTTTGGCGG - Intergenic
1158308407 18:56132095-56132117 CAGCTTAAGGAATTTTTGGGCGG - Intergenic
1159931216 18:74315028-74315050 CAGCCTCGTGCATGTCTCGGGGG - Intergenic
1162391043 19:10390384-10390406 CAGAATCAAGAATGTTTGGGGGG + Intergenic
926071057 2:9891596-9891618 CAGCCTCAGGCAGGTTCCGTAGG + Intronic
926660345 2:15458682-15458704 CAGCCTCAGGTATTTCTCTGTGG + Intronic
932050972 2:68397251-68397273 CAGCTTCAGGAATGTTACAGGGG - Exonic
936350501 2:111708771-111708793 CAGCCTCAGGCATGTGTCTTTGG + Intergenic
937288297 2:120766845-120766867 CAGCCTCTGGAATTTTTCCCAGG - Intronic
946357263 2:219195749-219195771 CATCTTCAGGAAAGTTTAGGTGG - Intronic
1169276441 20:4236395-4236417 CAGACTGAGGGATGTTTGGGAGG + Intronic
1176309468 21:5142060-5142082 CAGCCTCAGGCCTGTTGGGGAGG - Intronic
1176366713 21:6037572-6037594 CCGCCTCTGGAATGTATCAGGGG + Intergenic
1176966963 21:15222190-15222212 CAGCCTCAGGAAGGTCACAGGGG + Intergenic
1179756805 21:43500972-43500994 CCGCCTCTGGAATGTATCAGGGG - Intergenic
1179847592 21:44119973-44119995 CAGCCTCAGGCCTGTTGGGGAGG + Intronic
950177645 3:10886427-10886449 CAGCCACAGGAATATCTCAGGGG - Intronic
952020221 3:29009838-29009860 AAGGCTCAGGAATGTTTTGCTGG - Intergenic
956063796 3:65375745-65375767 CATCCCCAGGAATGATGCGGAGG + Exonic
958025631 3:88045670-88045692 CTGCCTCAGGAAGCTTTTGGAGG + Intergenic
958426507 3:93984493-93984515 CTGTCTCAGGAAGGTTTCAGAGG + Intronic
963511700 3:146255802-146255824 CAGCCTCAGGTATTTTTTTGTGG - Intergenic
966339670 3:178911668-178911690 CAGCCTCTGGAGGGTTTCAGAGG - Intergenic
966655584 3:182354273-182354295 CAGAATCAGGAATGTTTGTGTGG + Intergenic
966920823 3:184610418-184610440 CAGCCTCAGGAATGTTTCGGGGG + Intronic
967965021 3:194954183-194954205 CTGCCCCAGGAATGGTTCTGGGG + Intergenic
970038757 4:11771993-11772015 CATCCTGAGGAAGGTTTGGGGGG - Intergenic
972629937 4:40834081-40834103 CAGCCTCAGGCTTTTTTGGGAGG + Intronic
975315808 4:72952092-72952114 CAGCCTGAGAAATGTTTCCCTGG + Intergenic
980169362 4:129269637-129269659 CTGCCTCTGGAATGTTTCTCCGG + Intergenic
982587700 4:157263448-157263470 CAGCAACAAGAATGTTTAGGTGG - Intronic
983888728 4:173009224-173009246 CAGCCTCAGCTCTGTTCCGGTGG - Exonic
985787804 5:1908925-1908947 CAGCCTAGGGAATGTCTAGGTGG + Intergenic
986686976 5:10283246-10283268 CAGCCTGAGGAATGTCCCGCTGG + Intronic
986992540 5:13570927-13570949 CATCATCAGAAATGTTTCAGTGG + Intergenic
987377912 5:17253862-17253884 AAGCCTCCTGAATGTGTCGGTGG - Intronic
988133220 5:27134194-27134216 CAGCTTAAGGAATGTTTCAAAGG - Intergenic
990610894 5:57455901-57455923 CAGCCTCAGGGAGGTCTCAGAGG + Intergenic
994883602 5:105529440-105529462 CAGACTCAGGACTGTTGGGGAGG - Intergenic
995530901 5:113091107-113091129 CAGCCTCAGGATTCCTTCTGTGG - Intronic
1000352509 5:160363021-160363043 GAGCCCCAGGAGTGTTTCAGGGG + Intronic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1008060026 6:46987129-46987151 CAGCCTCAGGTATCTTTTTGTGG - Intergenic
1012227940 6:96726320-96726342 CAGCCTCAGCAATGCTTCCTTGG + Intergenic
1017424687 6:154308033-154308055 CAGTCTCAGCAATTTTTAGGGGG + Intronic
1018230352 6:161669418-161669440 CAGCCACAGCAATGTTTGGCTGG + Intronic
1019400764 7:851956-851978 CAGCCTCTGGAGTGTTCTGGTGG + Exonic
1019520667 7:1459360-1459382 CAGCCGCGGGAAGGTGTCGGAGG - Exonic
1025142128 7:56475186-56475208 CAGCCTCAGGCCTGCTTCTGAGG + Intergenic
1025708275 7:63886614-63886636 CAGCCTCAGGCCTGCTTCTGAGG + Intergenic
1029976045 7:104834765-104834787 CAGCTTCATGATGGTTTCGGTGG + Intronic
1031363161 7:120871313-120871335 CAGCATCAGGATTGTTTCAGGGG - Intergenic
1035750745 8:1994372-1994394 AAGCCTCTGGAATGTTCAGGCGG - Intronic
1036260063 8:7232402-7232424 CAGCCTCCTGAATTTTTAGGAGG - Intergenic
1036312104 8:7690971-7690993 CAGCCTCCTGAATTTTTAGGAGG - Intergenic
1040340403 8:46437626-46437648 AACCCCCAGGACTGTTTCGGCGG - Intergenic
1040863215 8:52022468-52022490 AAGCCTCTGGAAGGTTTTGGTGG - Intergenic
1051184529 9:14444591-14444613 AAGACTCAGAAATGTATCGGGGG + Intergenic
1056034851 9:82593663-82593685 AAGCCTCAGCAGTGTTTAGGAGG - Intergenic
1056099452 9:83286904-83286926 GAGACCCAGGAATGTTTCAGTGG - Intronic
1062242480 9:135547777-135547799 AACACTCAGGAATGTTTCAGTGG - Intronic
1062444599 9:136588331-136588353 CAGTCTCAGGAAAGCTTCTGGGG + Intergenic
1186562759 X:10630501-10630523 AAGTCTCAGGAATGTGTCTGAGG + Intronic
1192502018 X:71660670-71660692 CAGCCTCAGTATTGTGTGGGAGG + Intergenic
1198821211 X:140650468-140650490 CAGGCTCAGGGCTGTTTGGGAGG - Intergenic
1200060186 X:153480608-153480630 CAGCCTCAGGCTTGTCTGGGTGG - Intronic
1200071339 X:153530945-153530967 CAGCCTCATTAATATTTCAGAGG - Intronic