ID: 966921272

View in Genome Browser
Species Human (GRCh38)
Location 3:184613189-184613211
Sequence TCTGATACCCAGAGTGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 291}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966921269_966921272 -4 Left 966921269 3:184613170-184613192 CCAGCAGCTGCATTTGGCCTCTG 0: 1
1: 0
2: 1
3: 33
4: 269
Right 966921272 3:184613189-184613211 TCTGATACCCAGAGTGTGGATGG 0: 1
1: 0
2: 1
3: 24
4: 291
966921264_966921272 21 Left 966921264 3:184613145-184613167 CCGGGCAACCAGAATGGGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 215
Right 966921272 3:184613189-184613211 TCTGATACCCAGAGTGTGGATGG 0: 1
1: 0
2: 1
3: 24
4: 291
966921267_966921272 13 Left 966921267 3:184613153-184613175 CCAGAATGGGGAGGGGACCAGCA 0: 1
1: 0
2: 3
3: 13
4: 203
Right 966921272 3:184613189-184613211 TCTGATACCCAGAGTGTGGATGG 0: 1
1: 0
2: 1
3: 24
4: 291
966921259_966921272 30 Left 966921259 3:184613136-184613158 CCTCACAAACCGGGCAACCAGAA 0: 1
1: 0
2: 0
3: 4
4: 64
Right 966921272 3:184613189-184613211 TCTGATACCCAGAGTGTGGATGG 0: 1
1: 0
2: 1
3: 24
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966921272 Original CRISPR TCTGATACCCAGAGTGTGGA TGG Intronic
900559761 1:3298203-3298225 TCAGAGACCCTGAGTGTGCAGGG + Intronic
900952719 1:5867025-5867047 TGTGAGACCCAGAATGTGGTAGG - Exonic
901649678 1:10736434-10736456 TCTGATCCCGTGAGTCTGGATGG + Intronic
903928568 1:26849170-26849192 TCTGATTCCCAGAGTTGAGAGGG + Intronic
904979997 1:34491764-34491786 TCTGATATCCAGAGTCTACAAGG + Intergenic
906276261 1:44518391-44518413 TCTGTCACCCAGAGTGAGTAGGG - Intronic
907256008 1:53179696-53179718 TCTGAATCCAAGAGAGTGGAAGG + Intergenic
907760481 1:57353759-57353781 TCTGTTATTCACAGTGTGGAAGG - Intronic
908091408 1:60689418-60689440 TCTAATACCCAGAGTCTACAAGG + Intergenic
908173333 1:61529355-61529377 TCTGTCACCCACAGTTTGGATGG + Intergenic
910096611 1:83529813-83529835 TCTAATATCCAGAGTCTGCATGG + Intergenic
911652549 1:100406258-100406280 TCTAATATCCAGAGTCTGTAAGG - Intronic
913089221 1:115465302-115465324 ACTGAGGCCCAGAGTGGGGAAGG + Intergenic
915098892 1:153484495-153484517 CCTAATTCCCAGAGTGAGGAGGG - Intergenic
915287234 1:154860814-154860836 GCTGAGACCCAGTGTGTGGCTGG + Intronic
916059442 1:161088735-161088757 CCTGATGCCCAGAGAGTGGATGG - Intronic
916998067 1:170323063-170323085 TCTGATACCCAGAATCTATAAGG - Intergenic
918147475 1:181770285-181770307 CCTGATACCCAAAATGTGGTTGG + Intronic
918536198 1:185577493-185577515 TCTGATATCCAGAGTCTACAAGG - Intergenic
918655961 1:187027101-187027123 TCTGATCCCAAGAGGGTGGATGG - Intergenic
919111059 1:193219018-193219040 TCTAATACCCAGAATGTATAAGG + Intronic
919553889 1:199027940-199027962 TCTGACACCCACAGTTTAGAGGG + Intergenic
919762771 1:201108638-201108660 TCTGAGCTCCTGAGTGTGGAAGG - Intronic
920068263 1:203284516-203284538 TCTGAGACCCAGAGAGTCGGTGG + Intergenic
921562126 1:216671479-216671501 TGGGATACCCAGAGGCTGGATGG - Intronic
923473733 1:234314050-234314072 GCTGATGTCCAGAGAGTGGAAGG + Intronic
923795227 1:237147768-237147790 TCTGATAGCCACAGTGTTGCGGG - Intronic
924931268 1:248734254-248734276 TCTGAGAACAAGAGTGAGGAGGG - Intronic
924952924 1:248901874-248901896 TCTGATATCCAGAGTCTACAAGG + Intergenic
1064614145 10:17135352-17135374 TCTGAGACCCAGAGTTGGTAAGG + Intergenic
1064718790 10:18206563-18206585 TCTGAAAGCCAGAGAGTGGCTGG - Intronic
1067934471 10:50597458-50597480 TTTGATACACACAATGTGGATGG + Intronic
1067941911 10:50663697-50663719 TCTGATACCCACTTTGTGCAGGG - Intergenic
1069130650 10:64697891-64697913 TCTGATACCCAGAATCTACAAGG + Intergenic
1069287018 10:66728309-66728331 TCTAATATCCAGAGTGTACAGGG - Intronic
1069780197 10:70950544-70950566 CCTGAGACCCAGAGTTGGGAAGG - Intergenic
1070472043 10:76790423-76790445 TCTAATACCCAGAGTCTACAAGG - Intergenic
1070774971 10:79104136-79104158 TCTGAGGCCCAGAGAGGGGAGGG - Intronic
1070863154 10:79688648-79688670 TCTGATACCCACTTTGTGCAGGG - Intergenic
1071012395 10:80953728-80953750 GCAGATACCCAGAGTATGTAAGG + Intergenic
1071564691 10:86665625-86665647 TCGGTGACCCAGTGTGTGGAGGG + Intronic
1073947394 10:108766779-108766801 TCTGAGACCGAGTGTCTGGAAGG - Intergenic
1075429840 10:122371010-122371032 TCTGCTACCCAGTTTCTGGAGGG + Intergenic
1076047887 10:127309317-127309339 TCTGATATCCAGAATCTGCAAGG - Intronic
1077752883 11:4992013-4992035 TCTGATTCCCAGAGTGCTGCAGG - Exonic
1080152331 11:29067611-29067633 TTTGATACCCAGTTTGTTGAGGG - Intergenic
1080718072 11:34823419-34823441 CATGATACCCAGAGTGAGGGAGG + Intergenic
1081370352 11:42292957-42292979 TCTAATACCCAGAGTCTGCAAGG + Intergenic
1082108993 11:48252338-48252360 TCTGATACCCAGAATCTATAAGG - Intergenic
1082879873 11:58027175-58027197 ACTGATACCCAGGGTTTGGTTGG - Intronic
1083651522 11:64207332-64207354 GCTGCTACAGAGAGTGTGGAAGG - Exonic
1083680592 11:64349987-64350009 TCTGATACCCAGGCTGTGTGCGG + Intronic
1084105330 11:66976891-66976913 ACTGAGGCCCAGAGTGGGGAAGG + Exonic
1085270023 11:75264777-75264799 ACTGAGGCCCAGAGTGGGGAAGG + Exonic
1086820069 11:91424840-91424862 TCTAATACCCAGAATGTACAAGG - Intergenic
1087391635 11:97542318-97542340 TCTGATACCCAGAATCTACAAGG + Intergenic
1087912136 11:103766509-103766531 TCTGATATCCAGAATCTGTAAGG - Intergenic
1088385079 11:109245325-109245347 TCTAATATCCAGAGTCTAGAAGG + Intergenic
1090351399 11:126110757-126110779 CCCGGGACCCAGAGTGTGGAGGG - Intergenic
1090573987 11:128080375-128080397 TTTGATACCCAGTTTGTTGATGG - Intergenic
1090894166 11:130954658-130954680 TCTGAGACCCAGTGTGTAGAAGG - Intergenic
1093097458 12:14988140-14988162 TCTAATACCCAGAATCTGCAAGG + Intergenic
1093160298 12:15739447-15739469 TCTGCTGCCCTGAATGTGGATGG + Intronic
1094354166 12:29559800-29559822 TCAGATACCCAGAGAGAGAAAGG - Intronic
1096207841 12:49738386-49738408 TCTGATACATAGAGTGTAAAGGG - Intronic
1098563346 12:71902838-71902860 TCTAATACCCAGAATCTGTAAGG + Intronic
1098684924 12:73407875-73407897 TCTGATACCCAGAATCTATAAGG + Intergenic
1098700754 12:73622493-73622515 TCTGATATCCAGAATCTGCAAGG - Intergenic
1101029347 12:100644581-100644603 TCTGACACACAGAGTGTAAAGGG + Intergenic
1101075248 12:101122268-101122290 TCTAATACCCAGAATCTGTAAGG - Intronic
1101075411 12:101124348-101124370 TCTGATATCCAGAGTCTACAAGG - Intronic
1101530146 12:105566454-105566476 TCTGAAACCCTGAGGGTGGGGGG - Intergenic
1101976890 12:109367477-109367499 TTTCATACCCAGTTTGTGGAAGG + Intronic
1102795071 12:115682105-115682127 TCTGAGACCCAGAGGGATGAAGG - Intergenic
1102795895 12:115688521-115688543 TATGGTACCCAGAGTCTTGAAGG - Intergenic
1103451548 12:121032778-121032800 TCTGACACCCAGTGAGGGGAAGG - Intronic
1104166882 12:126240158-126240180 TCTGCCAACCAGAGTGTGGCAGG + Intergenic
1104262312 12:127195580-127195602 TCTAATACCCAGAATTTGGAGGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106271466 13:28158454-28158476 TCTGATACCCAGAATCTATAAGG + Intronic
1106402724 13:29445225-29445247 TCTGATGCCCGGGGTGTGGAGGG + Intronic
1106467813 13:30028444-30028466 GCTGATAGCCAGTTTGTGGAAGG + Intergenic
1107552784 13:41492845-41492867 TCTGAGGCCCAGAGAGGGGAAGG - Intergenic
1107829091 13:44358486-44358508 TCTGAGACCCAGAGTGTCTGTGG + Intergenic
1108843432 13:54649954-54649976 TATGGTACCCAGAGTGTTGCAGG + Intergenic
1109580367 13:64323567-64323589 TAAGATACACAGAGAGTGGAAGG + Intergenic
1112242004 13:97691585-97691607 TCTAATATCCAGAGTCTGCAGGG + Intergenic
1112501285 13:99945255-99945277 TCTGTCACCCAGAGGTTGGAGGG - Intergenic
1113813310 13:113154763-113154785 TCTGATGTCCACATTGTGGATGG - Intergenic
1114587184 14:23825772-23825794 TCTGACACCCATAATGTGGGTGG + Intergenic
1116083436 14:40204716-40204738 CTTGATACCCAAAGTCTGGAGGG + Intergenic
1116163014 14:41293744-41293766 TCTGATACCCAGAATCTTTAAGG + Intergenic
1116785390 14:49282082-49282104 CCTGATACCAAAAGTGAGGAAGG + Intergenic
1117360798 14:54971789-54971811 TCTGATATCCAGAGTCTATAAGG + Intronic
1117889639 14:60405309-60405331 TCTTATATCCAGAGTCTGCAAGG - Intronic
1118522063 14:66596511-66596533 TTTGGTACCCAAAGTCTGGAGGG + Intronic
1122284067 14:100640448-100640470 TCTGTGTCCCAGTGTGTGGAGGG + Intergenic
1125271686 15:37945749-37945771 TCTAATACCCAGAGTCTACAAGG - Intronic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1126934536 15:53691406-53691428 TCTAATACCCAGAATGTATAAGG - Intronic
1127163736 15:56220562-56220584 TCTAATATCCAGAGTCTGTAAGG - Intronic
1127676459 15:61243892-61243914 TCTGCTGACCAGAATGTGGAAGG - Intergenic
1129685310 15:77682745-77682767 TCTGATTGCCACTGTGTGGATGG - Intronic
1130092598 15:80833539-80833561 TCTGATACCCAAAGGAAGGATGG - Intronic
1130412994 15:83662915-83662937 TCTGCTACCCAGAGGGCAGAGGG - Intronic
1130555695 15:84921028-84921050 ACTGAGACCCTGAGTGTGGCTGG + Exonic
1130662048 15:85838531-85838553 TCTAAAAGCCAGTGTGTGGAGGG - Intergenic
1131442907 15:92472197-92472219 GCTGACCCCCAGAGTGGGGAAGG + Exonic
1131620077 15:94058909-94058931 TTTGAGACCCAGAGTGAGGAAGG - Intergenic
1133549994 16:6845059-6845081 TCTAATATCCAGAGTGTACAAGG - Intronic
1133725131 16:8530352-8530374 TCTGAGACCCAGAGACTGAAAGG - Intergenic
1133907226 16:10033369-10033391 TCAGAAACCCAGAGCCTGGAGGG + Intronic
1134196539 16:12163403-12163425 TCTGCTACCCAGGGTGTTGAGGG + Intronic
1137412358 16:48239782-48239804 TCTAATATCCAGAGTCTAGAAGG + Intronic
1138969739 16:62130336-62130358 GCTGAGAATCAGAGTGTGGACGG + Intergenic
1139389161 16:66594927-66594949 TGTGATCCCAAGAGTGTGGGGGG + Intergenic
1141265210 16:82490306-82490328 TCTGATGGCGAGAGTGGGGAAGG + Intergenic
1143986423 17:10918583-10918605 TCTAAGAACCAGATTGTGGATGG + Intergenic
1144441775 17:15289504-15289526 CCTGGGTCCCAGAGTGTGGAAGG + Intergenic
1144761285 17:17709032-17709054 ACTGAGGCCCAGAGAGTGGAAGG + Intronic
1145006891 17:19343350-19343372 TCTGATACACAGGGTGTGTTGGG - Exonic
1146760390 17:35471939-35471961 TCTAATACCCAGAATGTACAAGG - Intronic
1148470270 17:47888922-47888944 CCAGAGACCCTGAGTGTGGAGGG - Intergenic
1149818014 17:59745991-59746013 AATGATTCCTAGAGTGTGGAAGG + Intronic
1150457176 17:65315732-65315754 TATGGTATCCAGAGTGTAGAAGG - Intergenic
1150621485 17:66811287-66811309 GCTGACACTCAGAGTGGGGACGG - Intergenic
1150959700 17:69900171-69900193 ACTGTTGCCCATAGTGTGGAAGG + Intergenic
1151404117 17:73875847-73875869 TTGGAAACCCAGAGTGAGGAGGG - Intergenic
1151422997 17:74010833-74010855 TCTGATATCCAGAATCTAGAAGG + Intergenic
1151692779 17:75697099-75697121 TGTGAGCCCCAGAGTGTGGCTGG + Intronic
1152258984 17:79256391-79256413 GCTGAAGCCCAGAGTGAGGATGG + Intronic
1152329087 17:79660410-79660432 TCTGATAGCCAGAGTCTATAAGG + Intergenic
1152534140 17:80940805-80940827 TCTGCAGCCCAGAGTGGGGAGGG + Intronic
1153495116 18:5690040-5690062 TCTAATAGCCAGAGTCTGCAAGG - Intergenic
1153535536 18:6098022-6098044 TCTGATTCCAAGAGTCTAGATGG + Intronic
1154271196 18:12921361-12921383 TATGATACTGAGAGTGTGAAAGG - Intronic
1154999759 18:21674844-21674866 CCTGATAGCCAGAGGGAGGAGGG - Intronic
1155769393 18:29677807-29677829 TCTAATATCCAGAGTGTGTAAGG + Intergenic
1155847611 18:30729241-30729263 TCTAATACCCAGAGTCTACAAGG - Intergenic
1156147706 18:34205750-34205772 TCATATTCCCAGAGTGAGGAGGG - Intronic
1156419400 18:36934203-36934225 ACAGATACCAAGAGTGAGGAGGG - Intronic
1156848536 18:41698665-41698687 TGTGCTACCCAGGGAGTGGAGGG + Intergenic
1160048154 18:75406864-75406886 TGTGATGTCCAGTGTGTGGATGG + Intergenic
1162018446 19:7857917-7857939 ACTGAGAGCCAGAGTGGGGAAGG + Intronic
1166299894 19:41907614-41907636 CCTCATACCCAGTGTGTGTACGG - Intronic
1166519401 19:43470261-43470283 TCTGAGACCCAGAGAGAGGAAGG + Intergenic
926319297 2:11737496-11737518 TCTGATACCCAGAATTTAAAAGG + Intronic
926856351 2:17260367-17260389 TGTTATACACAGAGTTTGGAGGG + Intergenic
927005909 2:18848217-18848239 TCTGAGACCCAGGATTTGGATGG - Intergenic
927045945 2:19278452-19278474 TCTAATATCCAGAGTCTGCAAGG - Intergenic
927390923 2:22594487-22594509 TCTAATATCCAGAGTCTAGAAGG + Intergenic
928072680 2:28233192-28233214 TCTGATCCCCAGAGTGGTGCGGG - Intronic
928125473 2:28612456-28612478 GCTGAGCCCCAGAGTGAGGAAGG - Intronic
930149278 2:48041939-48041961 TCTGATATCCAGAGTCTGCAAGG - Intergenic
931676967 2:64706901-64706923 TCTGATACCCAGAATCTACAAGG + Intronic
932226347 2:70044079-70044101 TCTGAGAACCAGACTGAGGAAGG - Intergenic
932269275 2:70395188-70395210 TCTAATATCCAGAGTCTGCAAGG - Intergenic
932596242 2:73095412-73095434 TCTGATACCCAAAGTGTAGGTGG + Intronic
933437472 2:82266489-82266511 TCTGATACCCTGTGTGTTGTAGG - Intergenic
936036927 2:109120495-109120517 TCTGATACCCTGGGGGTGGAGGG - Intergenic
939636443 2:144588672-144588694 TCTGAAACCCAGAGTTAGGCAGG - Intergenic
940804457 2:158170598-158170620 TCTAATACCCAGAGTCTACAAGG + Intergenic
941057886 2:160808926-160808948 TCTAATACCCAGAGTCTACAAGG - Intergenic
941135216 2:161707953-161707975 CGTGATACCCATAGTTTGGAAGG + Intronic
944280055 2:197885476-197885498 GCTGATGCCCACAGTGGGGAGGG + Intronic
946026841 2:216676975-216676997 TCTCATCCCCAGAGAGTTGAGGG + Intronic
946065746 2:216985862-216985884 ACTGAGGCCCAGAGTGGGGAAGG + Intergenic
946370938 2:219280843-219280865 TCTGCTCCCCAGAGTCTGGTAGG + Intronic
946656387 2:221952500-221952522 TCTGATACCCAGATTGGGGTAGG + Intergenic
948569287 2:238907279-238907301 TCTGAGACCCAGGGTGTACAGGG - Intronic
948610817 2:239165617-239165639 TCTCATCCCCCGACTGTGGATGG + Intronic
1168799087 20:633240-633262 GCTGAGACTCAGAGTGGGGAAGG + Intergenic
1169565109 20:6845358-6845380 ACTGAAACCCAGAGTGTTAAAGG + Intergenic
1170738511 20:19031859-19031881 TCTGACTTGCAGAGTGTGGAAGG - Intergenic
1171946326 20:31381486-31381508 ATTGATACACATAGTGTGGATGG + Intronic
1172033127 20:31995469-31995491 ACTTATACTCAGAGTGAGGAGGG + Intronic
1172569669 20:35960069-35960091 TCTGATAGCAAGAGCTTGGATGG + Intronic
1172594293 20:36139657-36139679 ACTGAGACCCAGAGAGGGGAAGG - Intronic
1173055672 20:39610185-39610207 TCTAATACCCAGAATCTGCAAGG + Intergenic
1173154082 20:40593244-40593266 ACTGATACCCAGAGAATGAAAGG + Intergenic
1173292294 20:41725602-41725624 TCTGATTCTCAGACTATGGATGG + Intergenic
1173371310 20:42438996-42439018 TCTGGCACTCAGAGTCTGGAAGG - Intronic
1174045155 20:47728029-47728051 TCGGATCCCCACAGTGGGGAAGG + Intronic
1174091980 20:48056539-48056561 TCAGATAACTAGAATGTGGAAGG - Intergenic
1175497135 20:59423004-59423026 TCTGAGACCCAGAGCGGGGCAGG + Intergenic
1175769010 20:61611210-61611232 TCTGATCCCCAGGGAGAGGAAGG - Intronic
1176218017 20:63957345-63957367 GCTGACCCCCAGAGTGTGGTGGG - Exonic
1177879912 21:26680325-26680347 TATGCTACCCAGAATGTGGCTGG + Intergenic
1179178662 21:39026973-39026995 TATGGTACCCAGAGTGAGGAAGG + Intergenic
1179289435 21:40005910-40005932 GCTGGGATCCAGAGTGTGGATGG + Intergenic
1180724773 22:17938658-17938680 TTTGATACCCAGAGTCTTAAAGG + Intronic
1183239091 22:36642485-36642507 TCAGAGACCCAGTGTGTGGGTGG - Intronic
1185377051 22:50487499-50487521 GCTGCTCCCCAGGGTGTGGATGG - Intronic
949509417 3:4755247-4755269 TCTGATCCACACAGGGTGGAGGG + Intronic
951345914 3:21546953-21546975 TCAGATACCCAGGGTATGTAGGG - Intronic
951897193 3:27620977-27620999 TCTGATATCCAGAGTCTACACGG - Intergenic
952058685 3:29480745-29480767 TATGATAACCAGTGTATGGATGG + Intronic
952614525 3:35253871-35253893 TCTAATACCCAGAGTCTATAAGG + Intergenic
953532192 3:43748681-43748703 TCTGATACACAAAGTGTTCAGGG - Intergenic
954527672 3:51287078-51287100 TCTGATAACCAGAATCTGTAAGG + Intronic
956398461 3:68850761-68850783 TCTGATACCCAGAATCTACAAGG - Intronic
960500359 3:118430462-118430484 TCTGATATCCAGAATGTATAAGG - Intergenic
960500440 3:118431246-118431268 TCTGATATCCAGAATGTATAAGG - Intergenic
962599856 3:136983498-136983520 ACTGATCCCAAGAGTTTGGAAGG + Intronic
966921272 3:184613189-184613211 TCTGATACCCAGAGTGTGGATGG + Intronic
969851616 4:9961823-9961845 TCTAATATCCAGAGTCTAGAAGG + Intronic
971550587 4:27950966-27950988 TCTAATATCCAGAATGTGTAAGG + Intergenic
972214934 4:36886506-36886528 TCTGATATCCAGAATCTGTAAGG - Intergenic
972665763 4:41163745-41163767 TCACATGCCCAGAGTATGGAAGG - Intronic
972834158 4:42848615-42848637 TCTAATACCCAGAATGTATAAGG - Intergenic
973961746 4:56117466-56117488 TCTGATTGCCAGAGGCTGGAAGG + Intergenic
974366312 4:60954250-60954272 TCTAATATCCAGAGTCTGTAAGG - Intergenic
975205768 4:71642865-71642887 TCTGACACCTAGAGTGTAAAGGG - Intergenic
976274413 4:83261531-83261553 ACTGGCACCCAGAGGGTGGAGGG + Intronic
976941739 4:90710166-90710188 TCTAATATCCAGAGTCTAGAAGG - Intronic
978110433 4:104958003-104958025 ACTAATACCCAGAATGTGGAAGG - Intergenic
983851991 4:172592419-172592441 TTTGATCCCCAGTGTGGGGATGG - Intronic
984420208 4:179511743-179511765 TCTGATAAACAGAGCGTGGTGGG + Intergenic
984482489 4:180323714-180323736 TCTAATATCCAGAGTCTGTAAGG - Intergenic
984841174 4:184069148-184069170 GCTGATTCCCAAAGTGTGGTAGG + Intergenic
984901265 4:184588727-184588749 ACTAATACACAGAATGTGGATGG - Intergenic
986200380 5:5573644-5573666 TCTGAGAGCCAGAGCGTGGGAGG - Intergenic
986971493 5:13342398-13342420 TCTGATATCCAGAGTCTACAAGG + Intergenic
987635242 5:20530999-20531021 TCTAATACCCAGAGTCTACAAGG + Intronic
987900884 5:24010472-24010494 TCTGATTCCTAGATTGTTGAGGG - Intronic
989468209 5:41782625-41782647 ACTAATATCCAGAGTCTGGAAGG - Intronic
991985050 5:72276677-72276699 TCTAATATCCAGAGTCTGCAAGG + Intronic
992025721 5:72666930-72666952 TATGTTACCGGGAGTGTGGAAGG + Intergenic
994032442 5:95159635-95159657 TCTGATACACTGGGTATGGATGG - Intronic
994228085 5:97277482-97277504 TCTAATATCCAGAGTCTGCAAGG + Intergenic
994497285 5:100529455-100529477 TCTAATACACAGAGTCTGCAAGG - Intergenic
996403613 5:123087275-123087297 TCCGCTTCCCAGAGTGTGGGCGG + Intergenic
996708774 5:126523403-126523425 TCTGATGCACAGAGAGAGGATGG - Intergenic
997683666 5:135773823-135773845 TCTAATATCCAGAGGGGGGAGGG + Intergenic
999246974 5:150160242-150160264 ACTGAGGCCCAGAGAGTGGAGGG + Intergenic
999670798 5:153957629-153957651 CCTGATACCTAAATTGTGGATGG - Intergenic
999831621 5:155325578-155325600 TCTAATACCCAGAATCTAGAAGG - Intergenic
1000145545 5:158449823-158449845 TCTGATACACAGGGTGAGGCTGG - Intergenic
1001152148 5:169241178-169241200 TCTGGTTGCCAGAGAGTGGATGG - Intronic
1001206975 5:169773086-169773108 TCAGATCTCCAGAGTGTGGAAGG - Intronic
1001950086 5:175810259-175810281 ACTGAGACCCAGAGTGGGGAGGG + Intronic
1003269092 6:4591620-4591642 TCAGATACACAGAGTTGGGAGGG - Intergenic
1004352272 6:14900725-14900747 TCTAATACCCAGAATTTAGAAGG + Intergenic
1006922108 6:37633889-37633911 GCTGAAGCCCAGAGTGGGGAAGG - Exonic
1008118944 6:47587982-47588004 TCTGATTCCCAGTCAGTGGATGG + Intronic
1008126941 6:47679313-47679335 TCAGATACCCAAAGTTTAGAAGG - Intronic
1008307292 6:49918802-49918824 TCTGGTACCCAGTCTTTGGATGG - Intergenic
1008363935 6:50653614-50653636 TGTGTTACCCAGAGAGTTGATGG - Intergenic
1008834147 6:55805947-55805969 TCTGATACCCAGAATCTACAAGG - Intronic
1010084745 6:71904137-71904159 TCTGATACCCACAGTGTGATAGG + Intronic
1011321499 6:86098621-86098643 TGTGATTCCCAGAGTGTGAATGG - Intergenic
1012773789 6:103478570-103478592 TCTGATATCCAGAGTGGGAGAGG + Intergenic
1013380364 6:109563225-109563247 TCTGATGCCAAGGGAGTGGATGG + Intronic
1014158116 6:118135677-118135699 TCTGCTGCCCAGAGAGTGAAGGG + Intronic
1014624697 6:123711241-123711263 TCTGATAAGCAGATTCTGGATGG - Intergenic
1016729903 6:147417949-147417971 TCTGAAACCCAGAGTGGAGAGGG + Intergenic
1016881964 6:148920436-148920458 TCTGATGCCCTGAGGATGGAGGG + Intronic
1017832225 6:158140841-158140863 TCTGACACCAGGAGTGTGGAGGG - Intronic
1021572596 7:22081530-22081552 TCTGTGAACCAGAGTGGGGAGGG + Intergenic
1022039214 7:26564085-26564107 TCTAATATCCAGAGTATGCAAGG + Intergenic
1023993128 7:45142041-45142063 TCTGAGACCCAGAGAGGGGACGG - Intergenic
1024062939 7:45712610-45712632 TCTAATACCCAGAGTTGGGGAGG - Intronic
1024230837 7:47362073-47362095 GCTGAGACCCAGAGTGGGGCGGG + Intronic
1024986228 7:55195321-55195343 TCTGTTACCCAGAGATGGGAGGG + Intronic
1024998418 7:55294212-55294234 GGTGATACCCAGGGTCTGGAGGG - Intergenic
1025027982 7:55533865-55533887 TCTCGTACCCAGTGTGTGGTGGG + Intronic
1029862307 7:103586032-103586054 TTTGATGCCCAGATTGTTGAGGG - Intronic
1031124011 7:117753023-117753045 TCTCATACCCAGAGTCTACAAGG + Intronic
1033496348 7:141900503-141900525 TCTGAGACCCACAGTTTAGAAGG + Intergenic
1033565378 7:142573636-142573658 TCTAATATCCAGAGTCTGCAAGG + Intergenic
1033690362 7:143730481-143730503 TCTGATATCCAGAATCTGCAAGG - Intergenic
1036436558 8:8739704-8739726 TTTGATATCCAGTTTGTGGAGGG - Intergenic
1037905657 8:22714665-22714687 TCTGATACCCAGACAGAAGAGGG + Intronic
1038142276 8:24858959-24858981 TCTGATTCCAAGAGGCTGGAAGG - Intergenic
1038173270 8:25158271-25158293 TCTGATATCCAGAATCTGTAAGG - Intergenic
1039764800 8:40616950-40616972 TCTAATAGCCAGAGTGAAGAAGG + Intronic
1041949360 8:63483824-63483846 TTTGATGCCTAGAGTGTTGATGG + Intergenic
1042586097 8:70340202-70340224 TCTGATATCCAGAGTCTACATGG + Intronic
1046450036 8:114377041-114377063 TTTGATACCTAGTCTGTGGAGGG - Intergenic
1049218882 8:141419962-141419984 GCTGCCACCCAGGGTGTGGAGGG + Intronic
1050688182 9:8195834-8195856 TCTGATATCCAGAGTATCTAAGG + Intergenic
1050785474 9:9395550-9395572 TCTGAAACCCAGAGTCTTGTAGG - Intronic
1052851360 9:33380383-33380405 ACTGAGGCCCAGAGAGTGGAGGG + Intergenic
1053264430 9:36700285-36700307 TCTGATACCCAAAGGCTGCAGGG - Intergenic
1054999725 9:71435502-71435524 TCAGAAACCCAAAGTGTGCAAGG + Intronic
1057745800 9:97750010-97750032 TCTGAGACCCAGAGAGTAGCAGG + Intergenic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1058959271 9:109977767-109977789 GCTGATACCCAGAGAGAGGCAGG - Intronic
1059739232 9:117133468-117133490 ACTGAGGCCCAGAGAGTGGAAGG + Intronic
1059870016 9:118562348-118562370 TCTAATACACTGAGAGTGGAGGG - Intergenic
1060298109 9:122356668-122356690 ACTGAGACCCAGAGACTGGAGGG - Intergenic
1061390463 9:130314864-130314886 ACTGAGGCCCAGAGTGAGGATGG + Intronic
1061620849 9:131810424-131810446 ACTGAGACCCAGAGTGCGGTGGG - Intergenic
1062157444 9:135060926-135060948 TCTGAAATCCAGAGAGTGGTTGG - Intergenic
1187533488 X:20116726-20116748 TATTATCCCCAGAGTGTGGCGGG - Intronic
1187603386 X:20858183-20858205 TGTGATACGTAGACTGTGGATGG + Intergenic
1188798727 X:34499959-34499981 GCTTATACCAAGATTGTGGAAGG + Intergenic
1189705550 X:43755780-43755802 CCTGAAACCCAGACTGAGGATGG - Intergenic
1189874593 X:45422524-45422546 TCTGATATCCAGAATGTATAAGG + Intergenic
1190735923 X:53256053-53256075 TCTCATCCCCACAGTGTGGAGGG - Exonic
1191036127 X:56028137-56028159 TCTGACACATAGAGTGTGAAGGG + Intergenic
1191884009 X:65871319-65871341 TCTAATATCCAGAGTCTGCAAGG - Intergenic
1192205243 X:69091477-69091499 GCTGAGAACCAGAGTGGGGAAGG - Intergenic
1193229362 X:79025852-79025874 TCTAATACCCAGAATATGTAAGG + Intergenic
1195172521 X:102282551-102282573 TCTGATGCCCAGTTTGTTGAGGG + Intergenic
1195186345 X:102404544-102404566 TCTGATGCCCAGTTTGTTGAGGG - Intronic
1195488150 X:105434591-105434613 TCTAATATCCAGAATTTGGAAGG - Intronic
1196132442 X:112171972-112171994 TCTGATATCCAGAGTGTAGAAGG + Intergenic
1196363655 X:114898282-114898304 TCTAATATCCAGAGTGTACAAGG - Intronic
1196422892 X:115540832-115540854 TCTGACACACAGAGTGTAAAGGG + Intergenic
1197800251 X:130340260-130340282 CCTGCTACCCAGAGGGTGAATGG + Exonic
1199026914 X:142950359-142950381 TCTAATATCCAGACTGTGCAAGG - Intergenic
1199297284 X:146173563-146173585 ACTGATACCCAGAGAAAGGAAGG - Intergenic
1199710807 X:150467790-150467812 TCTGAGACCCAGAGAGGGGCAGG - Intronic
1200337519 X:155365899-155365921 TCTGAAACCCAGAGCCTGAAGGG + Intergenic
1200348951 X:155475328-155475350 TCTGAAACCCAGAGCCTGAAGGG - Intergenic
1201270269 Y:12247299-12247321 TCTGATACATAGAGTGTAAAGGG - Intergenic