ID: 966921858

View in Genome Browser
Species Human (GRCh38)
Location 3:184617282-184617304
Sequence AAGAAGAAGGAGAAGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7471
Summary {0: 18, 1: 73, 2: 370, 3: 1367, 4: 5643}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966921854_966921858 -8 Left 966921854 3:184617267-184617289 CCTGAAAAAAGAAAGAAGAAGAA 0: 1
1: 2
2: 102
3: 859
4: 5551
Right 966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG 0: 18
1: 73
2: 370
3: 1367
4: 5643
966921852_966921858 20 Left 966921852 3:184617239-184617261 CCAGCCTGGGCAACAGAGCGAGA 0: 13859
1: 89903
2: 167511
3: 219270
4: 217578
Right 966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG 0: 18
1: 73
2: 370
3: 1367
4: 5643
966921851_966921858 30 Left 966921851 3:184617229-184617251 CCATTGCACTCCAGCCTGGGCAA 0: 36772
1: 108043
2: 179343
3: 213379
4: 164443
Right 966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG 0: 18
1: 73
2: 370
3: 1367
4: 5643
966921853_966921858 16 Left 966921853 3:184617243-184617265 CCTGGGCAACAGAGCGAGACTCT 0: 4406
1: 35153
2: 108095
3: 167633
4: 195830
Right 966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG 0: 18
1: 73
2: 370
3: 1367
4: 5643

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966921858 Original CRISPR AAGAAGAAGGAGAAGGAGAA GGG Intronic
Too many off-targets to display for this crispr