ID: 966922089

View in Genome Browser
Species Human (GRCh38)
Location 3:184619083-184619105
Sequence CTGAAAGTTCCCGCCTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 81}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966922082_966922089 13 Left 966922082 3:184619047-184619069 CCCTCTTCCTGGCAAGGGTCAGA 0: 1
1: 0
2: 2
3: 27
4: 211
Right 966922089 3:184619083-184619105 CTGAAAGTTCCCGCCTCTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 81
966922078_966922089 23 Left 966922078 3:184619037-184619059 CCTTCCTTCTCCCTCTTCCTGGC 0: 1
1: 1
2: 21
3: 231
4: 1998
Right 966922089 3:184619083-184619105 CTGAAAGTTCCCGCCTCTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 81
966922079_966922089 19 Left 966922079 3:184619041-184619063 CCTTCTCCCTCTTCCTGGCAAGG 0: 1
1: 0
2: 7
3: 52
4: 517
Right 966922089 3:184619083-184619105 CTGAAAGTTCCCGCCTCTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 81
966922083_966922089 12 Left 966922083 3:184619048-184619070 CCTCTTCCTGGCAAGGGTCAGAC 0: 1
1: 0
2: 1
3: 25
4: 149
Right 966922089 3:184619083-184619105 CTGAAAGTTCCCGCCTCTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 81
966922076_966922089 26 Left 966922076 3:184619034-184619056 CCTCCTTCCTTCTCCCTCTTCCT 0: 1
1: 14
2: 125
3: 1181
4: 6482
Right 966922089 3:184619083-184619105 CTGAAAGTTCCCGCCTCTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 81
966922084_966922089 6 Left 966922084 3:184619054-184619076 CCTGGCAAGGGTCAGACCCACAG 0: 1
1: 0
2: 1
3: 15
4: 213
Right 966922089 3:184619083-184619105 CTGAAAGTTCCCGCCTCTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 81
966922086_966922089 -10 Left 966922086 3:184619070-184619092 CCCACAGCCTGGTCTGAAAGTTC 0: 1
1: 0
2: 1
3: 20
4: 175
Right 966922089 3:184619083-184619105 CTGAAAGTTCCCGCCTCTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 81
966922075_966922089 27 Left 966922075 3:184619033-184619055 CCCTCCTTCCTTCTCCCTCTTCC 0: 1
1: 26
2: 244
3: 2126
4: 10853
Right 966922089 3:184619083-184619105 CTGAAAGTTCCCGCCTCTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966922089 Original CRISPR CTGAAAGTTCCCGCCTCTGC TGG Intronic
900748333 1:4376814-4376836 CTGAGAATTCCCGTCTCAGCTGG - Intergenic
901523947 1:9807667-9807689 CTGCAAGCAGCCGCCTCTGCAGG - Intronic
904777468 1:32919760-32919782 TCTAAAGTTCCCACCTCTGCTGG + Intergenic
909334475 1:74455662-74455684 CTGTAAGTTCCAGACTCTGAAGG + Intronic
912309959 1:108610221-108610243 CTAAAATTTCCCTTCTCTGCTGG - Intronic
920184357 1:204151229-204151251 TTAAAAGTTCCCGCCTCCTCAGG + Intronic
920285307 1:204874621-204874643 CAGATCCTTCCCGCCTCTGCCGG + Intronic
920825258 1:209418973-209418995 CTGAAACTTCTTGACTCTGCTGG - Intergenic
1063047170 10:2404060-2404082 CTGAGAGTCCCCGCACCTGCAGG - Intergenic
1065359456 10:24876118-24876140 CCCAAAGTGCCTGCCTCTGCAGG - Intronic
1065384933 10:25125280-25125302 CTGCAGGAGCCCGCCTCTGCCGG - Intergenic
1073053346 10:100683776-100683798 CTCAAAGCTCCAGCCTCGGCAGG + Intergenic
1074821682 10:117184159-117184181 CTTAAATTTCCAGCCTCTACTGG - Intergenic
1089456367 11:118628145-118628167 CTGAGAGTCCCCGCCTGGGCCGG + Exonic
1098524974 12:71476717-71476739 CTGAAAGTTCCAGCCTTGGCTGG - Intronic
1101820322 12:108179234-108179256 CTGAAAGTTCCTGACACAGCAGG - Intronic
1111172137 13:84541370-84541392 CTGAATTTTCCTGCCTCTTCAGG - Intergenic
1122286206 14:100654288-100654310 CTGAAAGTTTCGTCCTCTGTAGG - Intergenic
1125410587 15:39401900-39401922 CTGACAGTTCCAGCCTCTAATGG - Intergenic
1127834336 15:62778306-62778328 GTGAAATTTCCCTCTTCTGCGGG + Intronic
1128379774 15:67104051-67104073 TTAAAAGTGCCTGCCTCTGCTGG + Intronic
1133412772 16:5582091-5582113 CTGACAGCTCCCTCTTCTGCAGG + Intergenic
1137241099 16:46655083-46655105 CTGAAACGTCCCGCCTTTTCAGG - Intergenic
1140909372 16:79437908-79437930 CGGGAGGTTTCCGCCTCTGCAGG + Intergenic
1142412054 16:89921869-89921891 CTGGCAGGGCCCGCCTCTGCTGG + Intronic
1143039363 17:4022109-4022131 CTGCAGGTTCCAGCCTCTGCTGG + Intronic
1143323749 17:6084845-6084867 CTGAACATTCTCGCCTCTGTCGG + Intronic
1144536748 17:16097380-16097402 CTGAAAGTTCCAGCCCTTGCTGG - Intronic
1148562624 17:48614558-48614580 CTGGAAGCTGCCGCCGCTGCTGG + Exonic
1148623211 17:49050180-49050202 CTGAAATTTCCCCACTCTGTTGG + Exonic
1151703116 17:75753772-75753794 CTGGAAGTTCGAGCCCCTGCTGG + Exonic
1152101885 17:78306324-78306346 CTGAAAGCTCAGTCCTCTGCAGG + Intergenic
1154077993 18:11224024-11224046 CTGAATGTTCCCCCCTTTCCTGG - Intergenic
1163521653 19:17795315-17795337 CCGAATGTTCCCACATCTGCAGG - Intronic
1164596205 19:29531907-29531929 CTGAGAGTACCAGCCTCAGCAGG + Intronic
1166920496 19:46226161-46226183 GTGAAGCTTCCAGCCTCTGCAGG - Intergenic
926886794 2:17605482-17605504 CAGAAGGTTTCCTCCTCTGCTGG - Intronic
929363557 2:41124091-41124113 CTGAAAGATCCACCCTCTGCTGG + Intergenic
930013577 2:46955964-46955986 TTGTAACCTCCCGCCTCTGCAGG - Intronic
931748040 2:65307905-65307927 GTGAAAGTGCCCGCCAATGCGGG - Intergenic
935696946 2:105778306-105778328 CTGAAGGCTCCAGCCTCTGCTGG - Intronic
938078916 2:128358912-128358934 CTGACAGCTCCTGCCTATGCGGG + Intergenic
944703461 2:202265650-202265672 CAGAATGTTCCCGCCACAGCGGG - Intergenic
947444072 2:230149788-230149810 CTGCAAGTTTCAGACTCTGCCGG - Intergenic
947578456 2:231295335-231295357 CTGACAGTTCACGCCACTTCTGG - Intronic
1172116753 20:32577504-32577526 CTGCAAGTTCCCAGCTCTGGGGG + Intronic
1179411620 21:41167646-41167668 CCGGAAGCTCCCGCCACTGCCGG + Intergenic
1182774564 22:32821286-32821308 CTGAAAGTCCCTGTCACTGCTGG - Intronic
1182824853 22:33256087-33256109 CTGACAGTTCCCTGCTCGGCTGG - Intronic
1182900651 22:33895541-33895563 CTGCAAGCTCCCTCCTGTGCTGG + Intronic
1183580755 22:38725145-38725167 CTGAAATGTGCCCCCTCTGCAGG - Intronic
1184430728 22:44440360-44440382 CTGAAAGGTCCTGTGTCTGCTGG - Intergenic
950554569 3:13687492-13687514 CTCAAAGTTCCCACTTCAGCTGG - Intergenic
957489550 3:80906027-80906049 CTGACAGTCCCCTCTTCTGCTGG - Intergenic
960053514 3:113259925-113259947 CAGAAAGTTCCCACCTCTGTTGG + Intronic
966541248 3:181092540-181092562 CTGAAAGTTCCCCTCTCAGGTGG + Intergenic
966922089 3:184619083-184619105 CTGAAAGTTCCCGCCTCTGCTGG + Intronic
972397571 4:38671131-38671153 CAGAAAGTGCCCGGGTCTGCAGG + Intronic
976333326 4:83856881-83856903 CTGTAAGTTCCAACATCTGCTGG - Intergenic
978707682 4:111734685-111734707 CTGAAACTTCCAGCCACTGCTGG + Intergenic
978767459 4:112418758-112418780 AAGAAAGTTCCCTCCTATGCAGG - Intronic
983497632 4:168461134-168461156 CTGAAGCTTCCAGCCTCTGATGG + Intronic
986004990 5:3660160-3660182 CAGAACCTTCCCCCCTCTGCAGG + Intergenic
992232084 5:74673409-74673431 CAGAATGTTCCCACTTCTGCAGG + Intronic
999151177 5:149427242-149427264 CTGAAAGTTCCCACCCAAGCCGG + Intergenic
1000986142 5:167862674-167862696 TTGAAAGCACCTGCCTCTGCGGG + Intronic
1001846721 5:174928682-174928704 CTGAAAGTTACCTTGTCTGCAGG + Intergenic
1005479127 6:26238882-26238904 CTTAAAAATCCCGTCTCTGCTGG - Intergenic
1006074647 6:31523864-31523886 CTGAAAGGTCCCACATCGGCTGG + Intergenic
1007667755 6:43525634-43525656 CTGAGAGCTCCTGCCTATGCTGG + Intronic
1014674715 6:124349297-124349319 CGGGAAGTTCCCGCCTTTGTAGG - Intronic
1015137889 6:129894569-129894591 CTTAAAGGTCCCACCTCTTCAGG - Intergenic
1017976280 6:159360224-159360246 CTGAAAGTTCCCTTTTGTGCTGG + Intergenic
1019765196 7:2844480-2844502 CTCAAAGATCCCGCCTCTTTCGG - Intergenic
1023873469 7:44274889-44274911 CTGACAGTTCCCACATCTGGTGG - Intronic
1024344704 7:48301181-48301203 CTGAAAGTTCCAATCTCTTCTGG + Intronic
1028700029 7:93766779-93766801 CTGAATCTTCCCACCTCTCCTGG + Intronic
1029290758 7:99500470-99500492 CTGAAGGTTCCCGCCCTTGCCGG - Intronic
1038153096 8:24959766-24959788 CTGAAACTTTCAGGCTCTGCTGG - Intergenic
1049768375 8:144366567-144366589 CTTAAAGGTCCCACCTCTGGCGG + Intergenic
1052028015 9:23596169-23596191 CTGAAGCTGCCCGCCCCTGCCGG + Intergenic
1056082554 9:83111016-83111038 CTAAAAATTCCAGCATCTGCAGG - Intergenic
1057126429 9:92619565-92619587 CTGATCTTTCCCGCCCCTGCAGG - Exonic
1057610868 9:96542712-96542734 CTTAAACTCCCGGCCTCTGCCGG + Intronic
1058215760 9:102231663-102231685 CTGAAAGAACCTCCCTCTGCTGG - Intergenic
1062101521 9:134731017-134731039 CTGACAGTTCCTGTCTCTGGGGG + Intronic
1192044600 X:67658779-67658801 CTGAGTTTTCCTGCCTCTGCTGG - Intronic
1192330157 X:70168906-70168928 CTGAAAGAACTCGCCTCTGGTGG - Intergenic
1194403392 X:93465002-93465024 CTGAAAGTTCCCCAGTCTTCAGG - Intergenic
1195915231 X:109928911-109928933 CTCCAAGTTCCTACCTCTGCTGG - Intergenic