ID: 966922803

View in Genome Browser
Species Human (GRCh38)
Location 3:184625087-184625109
Sequence TGAGAGGTATAGAAATTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 317}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966922803 Original CRISPR TGAGAGGTATAGAAATTGAA TGG Intronic
902233260 1:15041771-15041793 TGAGAGGTCTGGAACTGGAAGGG - Intronic
902563979 1:17297823-17297845 TGAGCGTTGAAGAAATTGAATGG + Intergenic
903203327 1:21761487-21761509 TGAAAGGTATAAAAAGTGATGGG - Intronic
904859937 1:33528688-33528710 TGAGAGGCAGAGAAATGAAAGGG + Intronic
905155534 1:35976460-35976482 TTAGAGGTATAAAAATCCAAAGG - Intronic
906966415 1:50461408-50461430 TGACAGGTATACACTTTGAAGGG - Intronic
907759227 1:57341514-57341536 TCAGGGGGTTAGAAATTGAAGGG - Intronic
908223222 1:62029671-62029693 TGAGCAGTTTAGAAATTCAAAGG + Intronic
910066420 1:83157795-83157817 TGAAAAGTAAAGAAATTAAAAGG + Intergenic
911268532 1:95773055-95773077 AAAGAGGAATAAAAATTGAATGG + Intergenic
911430966 1:97786528-97786550 TGAGAAGGATAAATATTGAATGG - Intronic
913060198 1:115197555-115197577 TGAGAGGTATGGAAATCAACTGG - Intergenic
916477747 1:165186192-165186214 TGAGAGGTCAAGAAATTGAGAGG + Intergenic
916898382 1:169192178-169192200 TGAGAGGTGTAGACAATTAACGG + Intronic
917039622 1:170789847-170789869 TGAGAGGTATATTTATTTAATGG + Intergenic
917225851 1:172781580-172781602 TGAGAGTTTTAGAGATAGAAGGG - Intergenic
918243271 1:182638490-182638512 TGAGTGGTATAGAAAGTAAATGG - Intergenic
918653657 1:186997732-186997754 TGAGCGATATAGAAATTCCAAGG + Intergenic
918753643 1:188307026-188307048 TGAAAAGTATAAAAACTGAAAGG - Intergenic
918857333 1:189774723-189774745 TGAAATGGAGAGAAATTGAAAGG + Intergenic
918937955 1:190949039-190949061 TAACAGGAATAGAACTTGAAGGG - Intergenic
919636431 1:200007750-200007772 GGAGAGGGATAGAAAATGAGAGG + Intergenic
920610120 1:207427712-207427734 TGGGAGGCACAAAAATTGAAGGG + Intergenic
920659137 1:207900573-207900595 TGAGAAGTATAGATTTTTAAGGG - Intronic
920941500 1:210487563-210487585 TGAGAGGTATGGATAATGAATGG + Intronic
921355012 1:214277758-214277780 TAGGAGGTATGGAATTTGAAAGG - Intergenic
921384809 1:214557967-214557989 TGAGAGGTATGGGACCTGAAAGG + Intergenic
922009403 1:221566443-221566465 GGAAAGGAATAGAAATAGAAAGG + Intergenic
923467856 1:234265222-234265244 TGAGAGGAATAGAACATGAAGGG - Intronic
923551174 1:234965186-234965208 TGATAGGGACAGAAAGTGAAAGG - Intergenic
923572341 1:235127861-235127883 TGAATGCTATAGAAATTGCAGGG - Intronic
923643008 1:235784724-235784746 TGAGAGCTCAAGAAATTGAGTGG + Intronic
923710186 1:236382213-236382235 TTGGAGACATAGAAATTGAAGGG - Intronic
924593425 1:245424652-245424674 TGATAAGTATAGAAATGGAGAGG + Intronic
1062988485 10:1792043-1792065 TGAAAGGATTAGAAATTGCATGG + Intergenic
1063637223 10:7794338-7794360 TAAGAGGCATAGAAATTTGAAGG - Intronic
1063761449 10:9083110-9083132 TGAAAGGTTTAGAAAGGGAAAGG + Intergenic
1063949376 10:11208049-11208071 TGAGAGGCATAGACTTTGAGGGG + Intronic
1064438519 10:15332413-15332435 TGAGAAGTATAGAAAGTCACTGG - Intronic
1064494626 10:15896267-15896289 TCAGAGTTATAGAAAATGAAAGG + Intergenic
1066097096 10:32083076-32083098 TGAGAGGAATACAAAATCAATGG + Intergenic
1066774433 10:38873805-38873827 TAAAATGTAAAGAAATTGAATGG + Intergenic
1067391974 10:45871961-45871983 TGAAATGGATTGAAATTGAATGG - Intergenic
1067871314 10:49964063-49964085 TGAAATGGATTGAAATTGAATGG + Intronic
1068106325 10:52621289-52621311 TGAAAGATCTAGAAATTGAATGG - Intergenic
1068260278 10:54571647-54571669 TCAGAGGTTTAGAAATGAAATGG + Intronic
1068739929 10:60457247-60457269 TGATGGGTATGGTAATTGAAAGG + Intronic
1068761641 10:60717719-60717741 TGAGTGGTAATGAAGTTGAAGGG - Intronic
1069117340 10:64524172-64524194 TTAGATGTGTAGAAATAGAATGG + Intergenic
1069208629 10:65727060-65727082 AGAGAGGTACAGGAAATGAATGG - Intergenic
1070195670 10:74154223-74154245 TGAGAGGCACAGAGATAGAAAGG - Intronic
1070631513 10:78088325-78088347 GCTGAGGTCTAGAAATTGAAAGG - Intergenic
1071869560 10:89779580-89779602 GCAGAGGGATAGAAATTCAAAGG - Intergenic
1071952433 10:90719691-90719713 TAAGAGGTATACATATTTAAAGG + Intergenic
1072184736 10:93025668-93025690 TGATATGTAGAGAATTTGAAAGG + Intronic
1072525425 10:96266995-96267017 TGAGGTGTAGAGAAACTGAATGG + Intronic
1072559170 10:96554300-96554322 TGAAAAGTATTGACATTGAAAGG - Intronic
1072792703 10:98329881-98329903 TGAGAGGCATGGAAATTTTAAGG - Intergenic
1074136772 10:110634359-110634381 TTAGAGGAATACAAATTGACAGG + Intergenic
1074191449 10:111141153-111141175 TAAAAGGTATAGAATTTAAAGGG + Intergenic
1074395359 10:113093320-113093342 TGAGAGCTATAAAAATTGCTGGG + Intronic
1079051669 11:17166136-17166158 TGAGATGTAAAGAAGTTAAAAGG - Intronic
1086987538 11:93266685-93266707 TGAGAGGACTAGCAATGGAAGGG - Intergenic
1087117132 11:94537526-94537548 TGACAAGTATAGAAAATGAAAGG - Intergenic
1087135951 11:94720310-94720332 TGAGAGGTACAGGAATCGCATGG + Intronic
1087358060 11:97121043-97121065 TTAGAAGTATAGAAATTGGCCGG + Intergenic
1089824125 11:121257715-121257737 TAGGAGGTATGGAAATTTAAGGG - Intergenic
1090190821 11:124766358-124766380 AGTGAGGTATAGAGAATGAAAGG + Intergenic
1090278717 11:125438066-125438088 TGAGATGTACATAAATTGTAAGG - Intergenic
1093180004 12:15955680-15955702 TTAAAGGTATAGAGATTGCAAGG - Intronic
1093534847 12:20210381-20210403 TGACAGGAATAGAGATGGAATGG - Intergenic
1094091658 12:26656740-26656762 TAAGAGGTATTGTAACTGAAGGG - Intronic
1094273224 12:28640373-28640395 TGGTAGGTAAAGAAATAGAATGG + Intergenic
1095391840 12:41716274-41716296 TGAGAGGTATTAAAAATGAGTGG - Intergenic
1095714677 12:45329832-45329854 TGAAAGTAAGAGAAATTGAATGG + Intronic
1095817253 12:46438099-46438121 AGAGAGGAATAGAATGTGAATGG + Intergenic
1096849313 12:54425576-54425598 TGAAAGGAATATAAACTGAAGGG - Intergenic
1097905572 12:64915665-64915687 GCAGAAGTATAGCAATTGAATGG - Intergenic
1099082232 12:78199403-78199425 TCATAGAGATAGAAATTGAAAGG + Exonic
1099466135 12:82990146-82990168 GAAGAGGAATAGAAATTGAGTGG + Intronic
1103298133 12:119905751-119905773 TGAGAGGCAGAGAGAGTGAACGG + Intergenic
1103743928 12:123109432-123109454 TGCCAGGTCTAGAGATTGAATGG - Intronic
1105768148 13:23580642-23580664 TGAAAGGTATAGAACTGGAGGGG + Intronic
1106851383 13:33796848-33796870 ATAGAGGAATAGAAATGGAATGG + Intergenic
1109623902 13:64948934-64948956 TGAGAGGTTTCCAAAATGAATGG - Intergenic
1109949681 13:69484042-69484064 TAAGAGGTATAAAAATTGGAAGG - Intergenic
1110078621 13:71282604-71282626 TAAGAGGCATCCAAATTGAAAGG - Intergenic
1110441482 13:75531286-75531308 GGTGAGGTAAAGAAATAGAATGG + Intronic
1111702931 13:91713471-91713493 TCAGAGGTAGAGAAAATGACGGG - Intronic
1111813172 13:93118044-93118066 AGAGAGGTATAGAAATAGAGTGG + Intergenic
1113611556 13:111649014-111649036 TGAAAGGCATATAGATTGAAAGG - Intronic
1114998010 14:28383025-28383047 TGAGTGCTATAGAACTTCAAAGG - Intergenic
1115036791 14:28867540-28867562 AGAAAGCTACAGAAATTGAATGG + Intergenic
1118042069 14:61928165-61928187 TGAGTGTTATAGAAAATGGAGGG + Intergenic
1118265592 14:64291350-64291372 TGACAGGTCTTGAAAATGAAGGG - Intronic
1118493416 14:66284412-66284434 TGAGATGTATAGACAGAGAAAGG + Intergenic
1119285994 14:73455941-73455963 TCTGAGGCAGAGAAATTGAATGG - Intronic
1121617498 14:95322521-95322543 GGAGAGGTGTCGAAATTAAATGG + Intergenic
1122038898 14:98968178-98968200 TGAAAGGTCTTGAAGTTGAAAGG + Intergenic
1123188572 14:106544473-106544495 TGGGGGGTAAAGAATTTGAAGGG + Intergenic
1123397080 15:19948026-19948048 TGAGGGGTGAAGAACTTGAAGGG - Intergenic
1126324781 15:47464740-47464762 TAAGAGGTATTTAAATTAAAAGG - Intronic
1126379991 15:48036676-48036698 TGACAGGAAAACAAATTGAAAGG - Intergenic
1127268408 15:57379508-57379530 GGAGAGTTAAAGAAATTTAATGG + Intronic
1129778425 15:78252475-78252497 TGAGAGGAATAGGAAGAGAAAGG + Intergenic
1133513612 16:6484217-6484239 TGAGAGGTTTATGAAATGAATGG + Intronic
1133779226 16:8924371-8924393 AGATAGGTACAGAAAGTGAAAGG - Intronic
1134329420 16:13236779-13236801 TGAGAGGGCTAGAAAATGGAAGG - Exonic
1134407330 16:13972606-13972628 TTAGAGGCATAGGAATTGGAAGG - Intergenic
1135298878 16:21307513-21307535 GAAGAGGTCTATAAATTGAAGGG - Intergenic
1135783845 16:25330091-25330113 TGAGAGGCATAGATAGTGAATGG + Intergenic
1135820076 16:25677096-25677118 AGAGATGTATAGAAATGAAAGGG - Intergenic
1137773796 16:51039614-51039636 TGAGAGGAGGAGAACTTGAAAGG + Intergenic
1137844186 16:51671012-51671034 TGAAAGGTATGGAAATAGAAAGG + Intergenic
1138650023 16:58454780-58454802 TGGGAGGTGTAGAAAATGGAAGG + Intergenic
1138733308 16:59220575-59220597 TCTGAGTTATAGAAATTGTAAGG - Intergenic
1140266237 16:73423563-73423585 TAAGAGGTTTAGAAATTGGCTGG + Intergenic
1140286671 16:73609432-73609454 AGAGCGGACTAGAAATTGAAAGG + Intergenic
1142772091 17:2105641-2105663 TTAGAGGAACACAAATTGAATGG + Intronic
1142819085 17:2449727-2449749 AGAGATTTATAGAAATGGAAAGG + Intronic
1145703861 17:26854261-26854283 GGAAAGGAATAGAAATGGAAAGG + Intergenic
1149172486 17:53827271-53827293 TAAAAGGTATAAAAATTGGAAGG - Intergenic
1150102430 17:62435740-62435762 GGAGAGGGAGAGAAATGGAATGG - Intronic
1150543292 17:66126023-66126045 TTATAGGTATAGAAATGGATGGG - Intronic
1150923375 17:69506508-69506530 TGAGAGGAATGGAAATTCCAAGG + Intronic
1203193286 17_KI270729v1_random:208879-208901 TCAGATGGAAAGAAATTGAATGG + Intergenic
1203202648 17_KI270730v1_random:8309-8331 TCAGATGGAAAGAAATTGAATGG + Intergenic
1153908375 18:9684380-9684402 AGAGAAATATAGACATTGAAAGG - Intergenic
1155797103 18:30054127-30054149 TCAGATGTAGAGAAAATGAAGGG - Intergenic
1155829528 18:30495470-30495492 GGAGAGGTAAAGAAAGTGTAGGG + Intergenic
1156095054 18:33520379-33520401 TAACAGTTATAGAAATTGAGAGG + Intergenic
1156806407 18:41188156-41188178 TGAGAGCCAAAGAAATTGGAGGG + Intergenic
1162283547 19:9719847-9719869 TGAGAGGACTAGTAATAGAAGGG - Intergenic
1165205615 19:34182885-34182907 TCAGAGGTAGAGAGAATGAATGG - Intronic
1165217732 19:34288567-34288589 TGAGAGGTAGAGAAATGTAGGGG - Intronic
925997547 2:9305171-9305193 AGTGAGGTATAGATATTGGAGGG + Intronic
925997623 2:9305573-9305595 AGTGAGGTATAGATATTGGAGGG + Intronic
925997661 2:9305774-9305796 AGTGAGGTATAGATATTGGAGGG + Intronic
926381186 2:12291604-12291626 TGAGAGATTTAAAAATAGAAGGG + Intergenic
926474099 2:13300834-13300856 TGATATGTATAAAAATTGCATGG - Intergenic
926486767 2:13471676-13471698 TTAGAAGTATAGACATTGAATGG - Intergenic
926603677 2:14874970-14874992 TGAGAGAACTAGAAATAGAAAGG + Intergenic
927238969 2:20903018-20903040 ACAGAGTTATAGACATTGAAGGG - Intergenic
929832957 2:45363827-45363849 TGAGAAATTGAGAAATTGAATGG + Intergenic
929856328 2:45641320-45641342 TCAGAGGTAGAGAAAAAGAATGG - Intergenic
931292325 2:60883814-60883836 TTAAAGGTTTAGAAGTTGAAGGG + Intronic
932600668 2:73123019-73123041 TGAGAGGTACAGAAATGAAGGGG - Intronic
933261793 2:80139440-80139462 TGTGATGTACAGAAATGGAAAGG - Intronic
933540650 2:83637781-83637803 GGAGAGGTAGAGAAAATGTAAGG - Intergenic
937624141 2:124025025-124025047 GTAGAGGTATTGAAATTTAAAGG - Intergenic
938226134 2:129618138-129618160 TTAGAGGTAGGAAAATTGAAAGG + Intergenic
939582890 2:143972012-143972034 TGAGAGATATAGAACTTAAATGG - Intronic
939593490 2:144095702-144095724 TGGGAGGGAAAGAAATTAAAAGG - Intronic
940520520 2:154739971-154739993 AGTGGGGTATAGAAATGGAAAGG + Intronic
941465913 2:165826759-165826781 TTAGAGGAATAGAGATTGAGAGG - Intergenic
941519160 2:166517177-166517199 TGAGAGGGAGAGAAAAGGAAAGG - Intergenic
941751918 2:169142999-169143021 TGAGTGGTACAGAAATTGGCTGG - Intronic
941834442 2:170000796-170000818 TTAGAGGAATAGACATTGAAGGG + Intronic
942222101 2:173780472-173780494 TGACTGGTATAGGAATAGAAAGG - Intergenic
942888786 2:180962330-180962352 TGAGATGTATATATATTAAAGGG - Intergenic
943711460 2:191100288-191100310 TGAGAGAAATGGAAACTGAAGGG + Intronic
946049355 2:216849150-216849172 TTAGAGGCATATAACTTGAAGGG + Intergenic
947337077 2:229098511-229098533 TGAGAGATATAGAAAATTACGGG - Intronic
948972044 2:241436344-241436366 TAAGAGGTATCTAACTTGAAAGG - Intronic
1169036327 20:2455358-2455380 TGAGAGGAGTAGAAAAGGAAGGG - Intergenic
1169082158 20:2804256-2804278 GGAGATGTATAGAAATTCTAGGG - Intergenic
1170739093 20:19038028-19038050 AGGGAGGTATAAAAAATGAAAGG + Intergenic
1172713442 20:36945300-36945322 TTACAGGTACAGAAACTGAAGGG + Intronic
1173112681 20:40207609-40207631 AGAGAGCTATAGAAACTGAGTGG + Intergenic
1173610456 20:44363578-44363600 TGAGAGGCATAGAAAGGGAGGGG + Intronic
1176528982 21:7943503-7943525 TGAGAAGTAATGGAATTGAATGG - Intergenic
1176743593 21:10630897-10630919 TGAGGGGTGAAGAACTTGAAGGG - Intergenic
1177073505 21:16542569-16542591 TGTCAGATATAGAAATTGATAGG + Intergenic
1177637424 21:23805758-23805780 TGAGTGGTATAAAACCTGAAAGG - Intergenic
1179666878 21:42918969-42918991 AGAGAGGTATAGAAAGTGGTTGG + Intergenic
1183906124 22:41041615-41041637 TGTGTGGTAATGAAATTGAAGGG - Intergenic
1185254359 22:49824180-49824202 TGGTAGAGATAGAAATTGAAGGG - Exonic
1203302813 22_KI270736v1_random:88858-88880 TGAAATGGATAGGAATTGAATGG + Intergenic
949147922 3:725914-725936 TAACAGGTAGAGAAATTGAAGGG + Intergenic
949165286 3:933414-933436 TGGGAGGCTTAGAAATAGAAAGG - Intergenic
949608371 3:5678483-5678505 TCAGAAGTATAGAAAATGAGAGG - Intergenic
949609921 3:5693491-5693513 TGAGAGGTCTAGCAATCGAAGGG + Intergenic
951011628 3:17688815-17688837 TGAGAAATATAGAAAGTGGAAGG - Intronic
951018023 3:17750829-17750851 TGATAGATATATAAATTGAATGG - Intronic
951044580 3:18023959-18023981 TGAAAGGTGTAAATATTGAATGG - Intronic
951905804 3:27706167-27706189 CTGGAGGTATAGAGATTGAAAGG - Intergenic
954610644 3:51943014-51943036 TGAGGGGTAGGGAAAGTGAAAGG - Intronic
956350489 3:68329814-68329836 TGAGAGATAGAGAAATGGGAGGG + Intronic
957194864 3:77054676-77054698 AGAGAGTGATAGAAATAGAATGG + Intronic
957278955 3:78125337-78125359 TGAGAGGAGTAGCAATGGAATGG - Intergenic
957593980 3:82236598-82236620 TCAGAGGTATGGACAATGAAAGG + Intergenic
957799024 3:85050592-85050614 TGAGAGATCTAGAAATAAAATGG + Intronic
958783301 3:98568907-98568929 TGAGGTGAATAGAAATGGAAAGG - Intronic
959253836 3:103984907-103984929 TGAGATATAAACAAATTGAATGG + Intergenic
960114211 3:113877369-113877391 GGATAGTTATGGAAATTGAATGG - Intronic
960867974 3:122221264-122221286 TGAGGGGAAAAGAAAATGAATGG - Intronic
962441134 3:135417290-135417312 TGAGAGGTATAAAATTAGTAAGG + Intergenic
962522020 3:136206008-136206030 TAAGAGTTATAGAAATATAATGG - Intergenic
962661775 3:137609014-137609036 TGGGAGGTGAAGAATTTGAAAGG - Intergenic
963917722 3:150874650-150874672 TGAGAAGAAAAGAAATAGAATGG - Intronic
964330203 3:155593811-155593833 TGAGGGGTAAAGAAAGAGAAAGG + Intronic
965460999 3:168963244-168963266 TGAAAGGTATACAGATTGGAAGG - Intergenic
965704842 3:171495879-171495901 TGAGAGGTAGAAAAATTTAAGGG - Intergenic
966922803 3:184625087-184625109 TGAGAGGTATAGAAATTGAATGG + Intronic
967451505 3:189628962-189628984 TAAGAGGAACAGAAATTAAATGG - Intergenic
970705802 4:18800636-18800658 TGAAAGGTAAAGATATTGCAAGG - Intergenic
971731684 4:30391589-30391611 TGAGAGGAATAGAAGAGGAAAGG + Intergenic
972118504 4:35669310-35669332 TGAGAGCTACAGAAATTGAATGG - Intergenic
973872495 4:55180310-55180332 TGGGAGGTATACAAGTTGAATGG + Intergenic
973891329 4:55370198-55370220 TGTGGGGTATAGAAATGGAATGG - Exonic
973987496 4:56368997-56369019 GGAGAGGTATAGAAGCTGACAGG - Intronic
974348004 4:60706939-60706961 TTAAAGGTAAAGAAGTTGAAGGG - Intergenic
974904477 4:68038144-68038166 TGACTGGTATAGGAATAGAATGG - Intergenic
975871265 4:78781263-78781285 AGAGAGGTATACAAATTATAAGG + Intronic
976150526 4:82086745-82086767 TGAGAGGTAAAGCCATAGAATGG - Intergenic
976683073 4:87778957-87778979 TGATAGGTATAAAAATTAAATGG - Intergenic
978049875 4:104185255-104185277 AGAGAGCAATAGAAAGTGAATGG - Intergenic
978226881 4:106346553-106346575 TGAGATGTAAAGAAACAGAAAGG - Intronic
978742110 4:112148108-112148130 TGAGGGGAATAGAAATAGAAAGG - Intronic
980714683 4:136614344-136614366 TGAGAGCTATAGAGAGTAAATGG - Intergenic
981612382 4:146608679-146608701 TGAGAGAAAAAGAAATTTAAAGG - Intergenic
982783166 4:159512141-159512163 TCACAGGTCTACAAATTGAAAGG - Intergenic
984998283 4:185458316-185458338 TAAGAAGCATAGAAAATGAAAGG - Exonic
986089179 5:4487034-4487056 TGAGAGCTATATAAATCAAATGG - Intergenic
987707768 5:21477286-21477308 TTAGAGGTGTAGAAAATAAACGG + Intergenic
988051282 5:26034534-26034556 TGAGAGGTAGAGAAAGAGATAGG - Intergenic
988287111 5:29234362-29234384 TGAGATTTATAAAAATTTAAGGG - Intergenic
989066289 5:37465710-37465732 TTAGAGGTGTAGAAAATAAATGG + Intronic
989235223 5:39140400-39140422 GCAGAGATATAGAAATTAAAAGG + Intronic
990226163 5:53656927-53656949 TGAGAAGGGTAGAAACTGAATGG + Intronic
990284527 5:54287452-54287474 TGAGAGGTATCCAAGTTCAAAGG + Intronic
991173494 5:63657223-63657245 TGTCAGGAATAGAAATTGTAGGG - Intergenic
992411351 5:76508724-76508746 TGAGAGGCATACAAATTCATAGG + Intronic
993229111 5:85209187-85209209 TGCGAGTTATAAAAATTAAATGG + Intergenic
994419826 5:99518251-99518273 TTAGAGGTGTAGAAAATAAACGG + Intergenic
994487383 5:100396886-100396908 TTAGAGGTGTAGAAAATAAACGG - Intergenic
994987187 5:106951582-106951604 TGAGAGGAATAACAATAGAAAGG - Intergenic
995548149 5:113253233-113253255 TTAGACGTACAGAAACTGAAAGG + Intronic
995573514 5:113506136-113506158 TGGGAGGTACAGAAATAAAATGG - Intergenic
996204409 5:120714338-120714360 TGGGAGGTATAGAAATTTATTGG + Intergenic
996505823 5:124266707-124266729 TGAGAGTTATAGAAAATAAGTGG - Intergenic
996913947 5:128688890-128688912 TGAGAGGTAAATAAATTTAGTGG + Intronic
997416735 5:133734699-133734721 AGACATGTATACAAATTGAAAGG - Intergenic
998636176 5:143957353-143957375 TGAGAGCAATAGAAACTGAGAGG + Intergenic
999610076 5:153359758-153359780 TGAGAGGCAGAGAAAGGGAAGGG + Intergenic
999732520 5:154485294-154485316 TGAGGGATTTAGAAATTCAATGG - Intergenic
1000342104 5:160285792-160285814 TGAGGGCAATAGAAACTGAAGGG + Intronic
1000906889 5:166975106-166975128 TGTGAGGTATGTAAATAGAACGG + Intergenic
1000999106 5:167988470-167988492 AGAGAGTAACAGAAATTGAAGGG + Intronic
1003308281 6:4947628-4947650 AGAGAGGTTTAGAAACTGCACGG - Intronic
1004681798 6:17903101-17903123 TCACAAGCATAGAAATTGAACGG + Intronic
1005992400 6:30911513-30911535 TGAAAGGTATAGAGATGGGAAGG + Intronic
1006285323 6:33088929-33088951 TGTGAGGGGTAGAAAATGAAGGG - Intergenic
1007447680 6:41919815-41919837 TGTGAGGAATGGAAATGGAAAGG - Intronic
1007464945 6:42045140-42045162 GGAGAGGGATAGAATTGGAAGGG - Intronic
1007484365 6:42170688-42170710 TGAGAGGGATTTAAATAGAAAGG + Intronic
1008636871 6:53419507-53419529 GGAGAGGTATGTAGATTGAATGG + Intergenic
1008764161 6:54890996-54891018 TTAAAGGTATAAAAATTAAATGG - Intronic
1009020446 6:57943251-57943273 TTAGAGGTGTAGAAAATAAACGG - Intergenic
1009808343 6:68630678-68630700 GGAGAGGAATAAAAATGGAAAGG + Intergenic
1010042378 6:71400769-71400791 TGAGAGGAATCTAAATAGAAAGG + Intergenic
1010994756 6:82520423-82520445 TGAGAGACATAGTAATTGAGTGG - Intergenic
1012090325 6:94885576-94885598 TGAGAAGTATACAGATTGAAAGG - Intergenic
1012512637 6:100021830-100021852 TGAAAAGTATAGAAAATGCACGG + Intergenic
1013110550 6:107061580-107061602 TGTGTGGTAGAGAAACTGAAAGG - Intergenic
1013261532 6:108448847-108448869 TGAGAAGTATATAAATTCAAAGG + Intronic
1013491274 6:110648223-110648245 TTAAAGGTATATAGATTGAAGGG + Intronic
1013706150 6:112836935-112836957 TAAGAGATATATAAATTGGAAGG - Intergenic
1013711118 6:112900316-112900338 TGAAAGGAATAGAAAGGGAAGGG - Intergenic
1014288898 6:119535839-119535861 GGAGAGTTATAGAAAGTGTAGGG + Intergenic
1014340611 6:120201857-120201879 TAAAAGGTATACCAATTGAAAGG + Intergenic
1015717080 6:136204064-136204086 TTAAAGGTATAGAAAATGATAGG + Intergenic
1020515311 7:9110720-9110742 TGATAAGTGTAGAAATTGAAAGG + Intergenic
1020891174 7:13879660-13879682 TGAGAATTATAGCCATTGAAAGG + Intergenic
1022135193 7:27440852-27440874 TTACAGATAAAGAAATTGAAAGG - Intergenic
1022884014 7:34622932-34622954 GGAGAGGTATATAATTTAAAAGG - Intergenic
1024906246 7:54384505-54384527 TAAGAGGTAGAGATATTGATTGG + Intergenic
1026230219 7:68476422-68476444 GGGGAGGTTTAGAAACTGAATGG - Intergenic
1026633191 7:72056468-72056490 AGACAGGTAAAGAACTTGAAAGG + Intronic
1027277689 7:76576961-76576983 TGAAAAGTAAAGAAATTAAAAGG - Intergenic
1027542333 7:79483052-79483074 TGAGAGGTTTAGCTTTTGAAAGG + Intergenic
1027550799 7:79592127-79592149 TTTCAGGAATAGAAATTGAATGG + Intergenic
1028637154 7:93002113-93002135 GGAGAGGCAGAGAAATTAAAAGG - Intergenic
1028891361 7:95991815-95991837 TGGCAGGAAGAGAAATTGAAAGG - Intronic
1030175955 7:106653777-106653799 TGAGAGGTCTAGGAGTTGGATGG - Intergenic
1030625117 7:111836731-111836753 TGAGATGAATATTAATTGAATGG + Intronic
1030684628 7:112471937-112471959 TGAGAGCTGTTGAAATTTAAAGG + Intronic
1030992217 7:116314333-116314355 TGAGGGGAATGGGAATTGAAAGG + Intronic
1031874252 7:127120220-127120242 TGAGAGGTATAAAAAAGGGAGGG - Intronic
1032031578 7:128488609-128488631 GGAGAGGGAGAGAAATGGAATGG - Intronic
1032461560 7:132115151-132115173 AGAGAAGAATAGAAATTGATGGG - Intergenic
1033155535 7:138953942-138953964 TCAGAGGTACAGAAAATAAATGG + Intronic
1033764585 7:144474351-144474373 TGAAATGAATGGAAATTGAAGGG - Intronic
1034749605 7:153556339-153556361 AGAGATGTAGAGAATTTGAAGGG - Intergenic
1036110926 8:5901462-5901484 TGAGAAGTAAAGAGAATGAAAGG + Intergenic
1036272301 8:7317717-7317739 TGGGAGGTATAGAAGGTGAGAGG + Intergenic
1036349047 8:7992625-7992647 TGGGAGGTATAGAAGGTGAGAGG - Intergenic
1037422894 8:18722800-18722822 TGGGAGTGATAGAATTTGAATGG - Intronic
1038726598 8:30087618-30087640 TAAGAAGTATTGAAACTGAAAGG + Intergenic
1038826848 8:31012621-31012643 TCAGGGATACAGAAATTGAAGGG + Intronic
1038908007 8:31928808-31928830 TGAGAGCTATAGGTATTTAAAGG + Intronic
1039614794 8:38946779-38946801 TTAGAGATATAGAAAAAGAAAGG + Intronic
1039682865 8:39761451-39761473 TGAAATGTTTAAAAATTGAAAGG + Intronic
1039691537 8:39870094-39870116 TGTGAGTTATAGAAATTGCTTGG - Intergenic
1040776555 8:51050375-51050397 TGACAGAAATAGAAATTGAATGG - Intergenic
1041690936 8:60686435-60686457 TAAGAGGTGTAGACATCGAATGG + Intronic
1042126842 8:65546620-65546642 TCAGAGAAATAGAAATTAAACGG - Intergenic
1043106737 8:76123521-76123543 GGAGAGGTAAAAAAATTGCATGG - Intergenic
1043549812 8:81358071-81358093 TGAGATGTAAAGAAATTTTAAGG + Intergenic
1043602343 8:81955720-81955742 TGAGAAGTTTAGCAATGGAATGG + Intergenic
1045917337 8:107487580-107487602 AGAGAGCTAAAGAAATTGATGGG + Intronic
1046269619 8:111877189-111877211 TGAGACCAATAAAAATTGAATGG - Intergenic
1046404494 8:113755303-113755325 TAAGATGTGTAGAAATTGAGAGG - Intergenic
1046761527 8:118026398-118026420 AAAGAAGTAGAGAAATTGAAAGG - Intronic
1048303670 8:133268644-133268666 TTATAGGTAAAGAAGTTGAAGGG + Intronic
1050640768 9:7665068-7665090 GGAGAAGTATAGTAATAGAAGGG + Intergenic
1051874089 9:21772316-21772338 TGCTAGGTATAGAGTTTGAAAGG + Intergenic
1052339934 9:27354965-27354987 TAAGAGTTATAAAAATTAAATGG - Intronic
1052413954 9:28154072-28154094 TCAGAGCTATAGCAAATGAATGG - Intronic
1053122537 9:35557655-35557677 TGAGAGGTAAGGACATTGAGAGG + Intronic
1053154183 9:35763563-35763585 TGAGATATATAGAAATTGCCTGG + Intergenic
1055928413 9:81534311-81534333 AGAGAGGTAAAGAAACTGCAAGG - Intergenic
1056988219 9:91385358-91385380 GCAGAGGTATACAAATTGTATGG - Intergenic
1057544414 9:96006721-96006743 TGAGAGGCATTGAAAGAGAAGGG + Intronic
1057993299 9:99795935-99795957 TGAGTAGTAAAGAAACTGAAGGG - Intergenic
1058367896 9:104232099-104232121 TGAGAGGTATATATATTCTAAGG + Intergenic
1058368595 9:104237612-104237634 TTAGAGATCCAGAAATTGAAGGG + Intergenic
1058578113 9:106425316-106425338 TGAGAGGCAGAGCAATTGGAGGG - Intergenic
1061205005 9:129157882-129157904 TGAGAGGTAGAGGAAAAGAAAGG - Intergenic
1061426090 9:130499336-130499358 TGAGTTGTACAGAAATTCAATGG + Intronic
1203678362 Un_KI270756v1:42474-42496 TAAAATGTAAAGAAATTGAATGG - Intergenic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1192741775 X:73900316-73900338 TGGGAGGGATAAAGATTGAAAGG + Intergenic
1192972419 X:76247487-76247509 TGAAAGGTATCCAAATTGAAAGG - Intergenic
1194337312 X:92664520-92664542 TTAGAGCTATAAAAATTAAATGG + Intergenic
1194350347 X:92819043-92819065 TGAGAATTATAGAAATTCAGTGG - Intergenic
1194376990 X:93149037-93149059 TAAGAGCTATAGAAATACAAAGG - Intergenic
1196329352 X:114451863-114451885 TGAGAAGAATAGAAAGAGAAAGG - Intergenic
1196505187 X:116433998-116434020 AAAGAAGTATAGAAGTTGAATGG - Intergenic
1198698074 X:139365039-139365061 TGAGCAGTATAGAGAATGAATGG - Intergenic
1199462147 X:148096499-148096521 TGAGAGGTATAGAGTGTGAAGGG + Intergenic
1199563358 X:149187714-149187736 TAAGAGGTAGAGAAATAAAAAGG + Intergenic
1199673747 X:150167148-150167170 AGAGAGGGAAAGAAAGTGAAGGG + Intergenic
1200645737 Y:5781252-5781274 TTAGAGCTATAAAAATTAAATGG + Intergenic
1200658665 Y:5935685-5935707 TGAGAATTATAGAAATTCAGTGG - Intergenic
1201131859 Y:10958600-10958622 TGGAATGTAAAGAAATTGAATGG - Intergenic
1201196650 Y:11500933-11500955 TGGGATGGATTGAAATTGAATGG + Intergenic
1201216084 Y:11723782-11723804 TGAGAGGTAATCAAATGGAATGG + Intergenic