ID: 966927187

View in Genome Browser
Species Human (GRCh38)
Location 3:184652439-184652461
Sequence TGTGGGCCTCACCATAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966927187_966927194 8 Left 966927187 3:184652439-184652461 CCTCCCTTATGGTGAGGCCCACA 0: 1
1: 0
2: 0
3: 11
4: 105
Right 966927194 3:184652470-184652492 AACCAGCCCTGTGCCTACCCTGG 0: 1
1: 0
2: 2
3: 29
4: 189
966927187_966927197 14 Left 966927187 3:184652439-184652461 CCTCCCTTATGGTGAGGCCCACA 0: 1
1: 0
2: 0
3: 11
4: 105
Right 966927197 3:184652476-184652498 CCCTGTGCCTACCCTGGCCCTGG 0: 1
1: 2
2: 31
3: 115
4: 780

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966927187 Original CRISPR TGTGGGCCTCACCATAAGGG AGG (reversed) Intronic
900099818 1:957069-957091 CGTGGGCCAAACCAGAAGGGGGG - Intronic
900366453 1:2313787-2313809 TGGGGGCATCTCCATGAGGGAGG - Intergenic
900584987 1:3428383-3428405 TGTGGGCCTTGCCATAGGCGAGG - Intronic
901270754 1:7951638-7951660 GGTGGGCCTCAAGATAAGGAAGG + Intergenic
901754688 1:11434449-11434471 GGTGGGCCTCCCCCTGAGGGAGG + Intergenic
901853942 1:12032169-12032191 TGTGTCCGTCACCATGAGGGTGG + Intergenic
905156973 1:35992952-35992974 TGTGGACCTCTCTATAAGGCTGG + Intronic
905159252 1:36016953-36016975 TGAGGACCTAACCAAAAGGGAGG - Intronic
910859643 1:91731285-91731307 TGCGGACCTCAGCACAAGGGAGG - Intronic
914769942 1:150674997-150675019 TGTAGTCCTAACCACAAGGGAGG - Intronic
920960383 1:210658171-210658193 TGTGGGCCGGAACATAAGGGAGG - Intronic
923435537 1:233964453-233964475 GGAGGACCTCACCATGAGGGAGG + Intronic
1063963446 10:11326282-11326304 TGTGGGCAACACCATATTGGGGG + Intronic
1064590028 10:16879989-16880011 TGTGAGCCTCATCCTAAGGCTGG - Intronic
1073509596 10:104034845-104034867 TGTGGGCCCCACCTGAAAGGAGG + Intronic
1074403576 10:113162263-113162285 TGTGCTCCTCACAATAAGGCCGG + Intronic
1075907269 10:126092535-126092557 TGTGTGTCTCTCCAAAAGGGAGG - Intronic
1077062509 11:624077-624099 TGTGGGCATCACCCTCGGGGGGG + Intronic
1077891202 11:6419206-6419228 TGGGGGCCTCACCCTGCGGGCGG + Intronic
1083328156 11:61884111-61884133 TGTGGGCCTCTCCTTAAGGATGG + Intronic
1086870961 11:92036073-92036095 TATGGGCCTCCCCATTATGGTGG + Intergenic
1093014909 12:14145877-14145899 GGGAGGCCTCACAATAAGGGAGG + Intergenic
1094829637 12:34294222-34294244 TGCGTGTCTCACCAAAAGGGGGG - Intergenic
1096669300 12:53188983-53189005 TCTGGCCCTCACCTTCAGGGAGG + Exonic
1096982885 12:55738454-55738476 TGTGGGTCGCAGCCTAAGGGAGG - Intergenic
1101446866 12:104742813-104742835 TCTTGGCCTCACCAGACGGGTGG + Intronic
1101893138 12:108733140-108733162 TTTGAGCCTCACCATATGGCAGG - Intergenic
1103440750 12:120961150-120961172 TGTGGGCCTCCCCTGAAGGCTGG + Intergenic
1106787913 13:33125450-33125472 TTTGGGGCCCACCATAATGGTGG - Intronic
1107576708 13:41731870-41731892 TGGAGGCCTCACCATCACGGTGG - Intronic
1115346231 14:32346082-32346104 TGGGGGACTCATCATAAAGGGGG - Intronic
1121211600 14:92211555-92211577 GGGGGGCCTCACCATTATGGTGG + Intergenic
1121321616 14:92994912-92994934 GGTGGACCACACCATATGGGTGG + Intronic
1122031573 14:98916143-98916165 TGGGGGACTCAGCACAAGGGAGG - Intergenic
1127384904 15:58459648-58459670 TGTGGGCCACACCCTATGTGGGG - Intronic
1133487837 16:6237491-6237513 TGTTGGCCTCCCAATAAGGCAGG - Intronic
1134767813 16:16776723-16776745 TGTGGGCTTCATCTTAAGGCTGG - Intergenic
1138715862 16:59021499-59021521 TGTGGACCTCCCCAGCAGGGAGG + Intergenic
1146045593 17:29503444-29503466 TGTGGGGCTCACCAGAAAGAGGG + Intronic
1153084797 18:1271979-1272001 TGTGGCCATCATCATTAGGGAGG + Intergenic
1155225433 18:23725556-23725578 TCTGGGGCTCCCCATAAGGGGGG + Intronic
1155997169 18:32342417-32342439 TGTGTGCCATACCAAAAGGGTGG - Intronic
1166591944 19:44007507-44007529 TGTGGGCCTCCACAGAAAGGGGG - Intronic
926497507 2:13609237-13609259 TGTGGGCCTCAGTCTCAGGGAGG + Intergenic
928178704 2:29052791-29052813 TGTGGGCCACATCACAAGGCTGG + Exonic
932639999 2:73435711-73435733 TGTGGGCCTCACAACAGAGGAGG - Intronic
938757209 2:134391849-134391871 TTTGGGCCTCTCCAGGAGGGAGG + Intronic
946216229 2:218185892-218185914 TGTGGGCCTCAGCAAGAAGGTGG - Intergenic
947980408 2:234403785-234403807 TGTGCGCCCCAGCACAAGGGAGG - Intergenic
1168751385 20:284265-284287 TCTGGGCCTCAATATGAGGGAGG + Intronic
1169765324 20:9142178-9142200 TGTGGTCAGCACCACAAGGGTGG + Intronic
1171125369 20:22597700-22597722 TCTGGGGCTCACCATACGGTTGG + Intergenic
1173998719 20:47358885-47358907 CCTGGGCCTCACCAAAAGGGAGG + Intergenic
1175859449 20:62142732-62142754 GGTGGGGGTCCCCATAAGGGGGG + Intronic
1177427591 21:20944254-20944276 TGTGGGGCTTACCATATTGGAGG + Intergenic
1183322395 22:37173001-37173023 AGTGGGCCACACCAGAAGGAAGG - Intronic
1184677151 22:46049964-46049986 TGTCCTCCTCACAATAAGGGTGG - Exonic
949788142 3:7764107-7764129 GGTGGGCATCTCTATAAGGGAGG + Intergenic
955030016 3:55206976-55206998 TCTGGGGCTCACCATTAGAGTGG - Intergenic
956483235 3:69693981-69694003 TGGGGGCCCCTCCCTAAGGGTGG + Intergenic
959264244 3:104117718-104117740 TGGGGGCCTCACAATCATGGTGG - Intergenic
959338586 3:105098334-105098356 TGGAGGCCTCACAATAATGGTGG - Intergenic
962952082 3:140228692-140228714 TGGGGGCCTCACAATCATGGCGG + Intronic
965341941 3:167502219-167502241 TGAGGCCCTCACCAGAAGGTGGG + Intronic
966927187 3:184652439-184652461 TGTGGGCCTCACCATAAGGGAGG - Intronic
972722365 4:41713039-41713061 TGTGGGCTTCACCCTAAGGCTGG - Intergenic
972898480 4:43653936-43653958 TGTGGGCCTCACCCTGAGGTAGG - Intergenic
973150882 4:46887049-46887071 TGTGTGCCTCACATTAAGGAAGG + Intronic
974699650 4:65424052-65424074 GGTGGGACTCACCATTAGAGTGG - Intronic
978740831 4:112136150-112136172 TGGGGGCCTCATCATCATGGTGG - Intergenic
979177019 4:117678321-117678343 TGGGGGCCTCACAATCATGGTGG - Intergenic
980070437 4:128237654-128237676 TGTGTGCCTCACAATAAGGATGG + Intergenic
986180938 5:5392409-5392431 TGGAGGCCTCACCATCATGGTGG - Intergenic
986409690 5:7464943-7464965 TGGAGGCCTCACCATCATGGTGG + Intronic
991292023 5:65042355-65042377 TGAAGGCCTCACCTTCAGGGTGG + Intergenic
992837740 5:80656872-80656894 AGTGGGCCTCACTCAAAGGGAGG - Intronic
998267406 5:140676689-140676711 TGTGGGGCTCAGCATTGGGGTGG - Exonic
1001006538 5:168056050-168056072 TGAGGGACTCACCATATTGGTGG + Intronic
1002428092 5:179187556-179187578 TGGGGGCCTCCCCATGAGAGGGG - Intronic
1002537852 5:179887982-179888004 TGTGGGCCTCCGCCTAGGGGTGG - Intronic
1003548944 6:7084977-7084999 TGTGGGCCGCACCTTAAGGATGG - Intergenic
1003575349 6:7288512-7288534 TGTGGGCATGAGCATAGGGGAGG + Exonic
1003865895 6:10362397-10362419 TAGGGGCCTCACCCTAAGGTGGG + Intergenic
1006154283 6:32005909-32005931 TCTGGCCCTCACCATAGGAGGGG + Intergenic
1006160588 6:32038643-32038665 TCTGGCCCTCACCATAGGAGGGG + Intronic
1006407367 6:33853071-33853093 TGAGGGCCTCCCCATGAGGCTGG - Intergenic
1006931566 6:37692122-37692144 TGTGGGCCTCACCCTATCTGAGG - Intronic
1009386126 6:63085454-63085476 GGAGGGCCACACCCTAAGGGAGG + Intergenic
1010266974 6:73878484-73878506 TGAGGGCCTCAGCAAAGGGGAGG - Intergenic
1012992521 6:105940279-105940301 AGGGGAGCTCACCATAAGGGAGG + Intergenic
1017755373 6:157525128-157525150 TGTGAGCCTCTCCATAGGGCTGG + Intronic
1018570634 6:165205965-165205987 TGTGGGCCTCTCCATGGGGCTGG - Intergenic
1019192865 6:170263607-170263629 TGGGGTCCTGACCAGAAGGGAGG - Intergenic
1019386765 7:761463-761485 TGCAGGCCTCACCATCATGGTGG + Intronic
1019499962 7:1359923-1359945 TGTGGGGCCCACCAGGAGGGAGG + Intergenic
1024179563 7:46877345-46877367 TGGGGGCCTCACAATCATGGGGG - Intergenic
1030063533 7:105641704-105641726 TGTGGGCCTCACAGTTCGGGCGG - Intronic
1036696966 8:10981356-10981378 TGGAGGCCTCACCAGAAGGAAGG + Intronic
1037908421 8:22728986-22729008 AGTGTGCATCACCATATGGGTGG - Intronic
1041151288 8:54937515-54937537 TGTGGTTCTCACCCTAAAGGTGG - Intergenic
1045388396 8:101692219-101692241 TGTGGGTAGCACCATCAGGGTGG + Intronic
1046426739 8:114062043-114062065 TGTAGGCCTCACAATCATGGTGG - Intergenic
1047719590 8:127627271-127627293 TGTAGGAGGCACCATAAGGGAGG - Intergenic
1048968037 8:139628232-139628254 TGGTGGCCTCACCATGAGGGAGG - Intronic
1049323069 8:142007564-142007586 TGTGGGCCACAGCACGAGGGTGG - Intergenic
1050050156 9:1591451-1591473 TCTGTGCCTCACCACAAGGCAGG + Intergenic
1052606918 9:30715569-30715591 TGTGGGCATCAGCATAGAGGTGG + Intergenic
1054768989 9:69067197-69067219 TCCGGGCCTCACCACCAGGGCGG + Intronic
1056246624 9:84701793-84701815 TGTGGCTCTCACCGTAAGAGTGG + Intronic
1057690305 9:97277918-97277940 TGTGGGCCTCACAGTTAGGTGGG + Intergenic
1059990207 9:119858197-119858219 GGTCGGCCTCACCATCATGGTGG + Intergenic
1060003368 9:119978482-119978504 AGTGGGGCTCACAAAAAGGGTGG - Intergenic
1061807093 9:133142625-133142647 TGTGGGCCCCCCCATAGGGGTGG - Intronic
1061840205 9:133354328-133354350 TGTAGGTCTCACCGTGAGGGTGG - Intronic
1186006843 X:5081538-5081560 TGTGTGGCTCACAATAAAGGAGG + Intergenic
1190635365 X:52427403-52427425 AGTGAGACTCACCATAAGGGTGG - Intergenic
1199746943 X:150777804-150777826 TAGCGGCCTCACCATAAGTGGGG + Intronic