ID: 966928865

View in Genome Browser
Species Human (GRCh38)
Location 3:184662907-184662929
Sequence GTTCCCCCCAGCACACCGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966928865_966928868 -3 Left 966928865 3:184662907-184662929 CCCGACGGTGTGCTGGGGGGAAC 0: 1
1: 0
2: 0
3: 3
4: 101
Right 966928868 3:184662927-184662949 AACAGGCAGATGTGCTCCTTCGG 0: 1
1: 0
2: 1
3: 12
4: 173
966928865_966928869 1 Left 966928865 3:184662907-184662929 CCCGACGGTGTGCTGGGGGGAAC 0: 1
1: 0
2: 0
3: 3
4: 101
Right 966928869 3:184662931-184662953 GGCAGATGTGCTCCTTCGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966928865 Original CRISPR GTTCCCCCCAGCACACCGTC GGG (reversed) Intronic
900092403 1:926114-926136 GCTCCCTCCAGCACACCCGCAGG - Intronic
904189699 1:28734101-28734123 TTTCTCCCCAGCACACTGCCTGG + Intergenic
908356380 1:63327930-63327952 GTTCCTCCCAGGACACAGGCGGG - Intergenic
910501717 1:87900104-87900126 GTTCCTCCCAGCACTGGGTCTGG - Intergenic
911841450 1:102687119-102687141 TTGCCTCCCAGCACACCTTCAGG - Intergenic
915724091 1:158005492-158005514 GTTTCCACCAGCACACCAGCAGG - Intronic
920213496 1:204345766-204345788 GTTCCCCCCAGCAAAGCCACTGG + Intronic
920335042 1:205239403-205239425 GTTCTCCCCAGCACAGATTCAGG + Intronic
920859471 1:209693672-209693694 GCTCAGCCCAGCACACTGTCTGG + Intronic
1070387575 10:75939739-75939761 GTTCACCCCAGCCCAAAGTCCGG - Intronic
1071572857 10:86707642-86707664 GTCCTCCCCAGCAAACCGTGGGG - Intronic
1073327664 10:102651705-102651727 GTTGCCCCAAGCCCACCCTCAGG - Intronic
1075641796 10:124070018-124070040 GTCCCCCCCAGCACGTTGTCAGG + Intronic
1078896460 11:15601296-15601318 GTTCCCCACCCCACATCGTCTGG + Intergenic
1079449025 11:20583251-20583273 GTTCACCCCAGAACACCCTTGGG - Intergenic
1080064038 11:27988868-27988890 GTTCCCCCCAACACACCTAATGG - Intergenic
1083678927 11:64342494-64342516 GTTCCCAGCTCCACACCGTCTGG + Intronic
1084190232 11:67495336-67495358 CTTTCCCCCAGCACACAGCCTGG - Intronic
1084336460 11:68460699-68460721 GTTCCCCCCCGCCCGCCCTCTGG - Intergenic
1085784405 11:79438147-79438169 CTTCCCCCCAGCCCGCAGTCAGG - Intronic
1089788314 11:120923904-120923926 CATCCACCCAGCACACTGTCAGG + Intronic
1090224012 11:125057827-125057849 GTGCCCCCCCGCCCACCGCCTGG - Intergenic
1091310571 11:134572752-134572774 GTTCCCCAAAGCACAGCCTCTGG - Intergenic
1092708621 12:11310423-11310445 GTTCCTCCCAGCACAGAGTTGGG - Exonic
1092712829 12:11355578-11355600 GTTCCTCCCAGCACAGAGTTGGG - Exonic
1092716625 12:11395554-11395576 GTTCCTCCCAGCACAGAGTTGGG - Exonic
1096943785 12:55381152-55381174 GTTCCGCCCAGCCCACAGGCAGG + Intergenic
1102230168 12:111256806-111256828 CTTCCCCCAAGCACACCTTTAGG - Intronic
1104779549 12:131411282-131411304 GTTCCTCCCATCCAACCGTCTGG - Intergenic
1107964985 13:45589856-45589878 GTTCCCCACTGCACACCTCCAGG - Intronic
1113602257 13:111578243-111578265 GTACCCCACAACACACTGTCTGG + Intergenic
1118325765 14:64779350-64779372 GTTCCTCCCAACACCCCATCAGG + Intronic
1124687466 15:31794707-31794729 TCGCCCCCCAGCCCACCGTCTGG + Intronic
1129361778 15:75028979-75029001 CCTCACCCCAGCACACAGTCGGG - Intronic
1130104661 15:80920315-80920337 CTTCCCCCCAGCACACAGAGAGG - Intronic
1133038156 16:3046201-3046223 CTTCCCCCCAGGACCCCGTGGGG - Intergenic
1134844155 16:17425714-17425736 CTTTCCCCCAGCACACAGCCAGG + Intronic
1135340096 16:21637801-21637823 GGTCCCCACAGCACAGCGGCGGG + Intronic
1136546587 16:30958214-30958236 GTTCCCCCCACCCCCCCGCCCGG + Intronic
1137034798 16:35560726-35560748 ATTGCCCCCAGCAAACCTTCTGG - Intergenic
1137712031 16:50573266-50573288 GTGCCCCCCTGCACCCTGTCTGG + Intronic
1142119305 16:88378080-88378102 GATCCCCCCAGTTCACCGCCAGG + Intergenic
1145247546 17:21279640-21279662 GTTCTCCCCAGAACAGCATCAGG - Intergenic
1151945792 17:77319284-77319306 GTCCCCACCAGCACATGGTCAGG - Intronic
1152867004 17:82729961-82729983 GTTCCACTCAGCACAGCATCAGG + Intronic
1152867023 17:82730050-82730072 GTTCCACTCAGCACAGCATCAGG + Intronic
1156149022 18:34222471-34222493 GTTTTCCCCAGGACACTGTCAGG - Intronic
1157604235 18:48915659-48915681 CCTGCCCCCAGCACACCCTCAGG + Intergenic
1160387500 18:78505401-78505423 GTTCACTCCAGCACGGCGTCCGG + Intergenic
1161157355 19:2739580-2739602 GTCCCGCCCAGCTCACCGCCGGG - Intronic
1162419460 19:10557916-10557938 GATCCCACCAGCCCCCCGTCAGG + Intronic
1162430485 19:10625511-10625533 GCTCCTCCCAGCACAGCGCCAGG - Exonic
1162443384 19:10707280-10707302 GTTGCCCCCATCTCACCATCAGG + Exonic
1163726912 19:18928254-18928276 CGTCCACCCAGGACACCGTCTGG + Exonic
1167598012 19:50437462-50437484 CCTCTCCCCAGCACCCCGTCAGG + Exonic
1167725850 19:51212099-51212121 CCTCCCCCCATCACACCCTCAGG - Intergenic
1168316008 19:55485096-55485118 GTTCCTCCCAGCCCGCCCTCCGG + Exonic
928907632 2:36384164-36384186 GTTCACTCCAGCACACCTTCAGG - Intronic
938716918 2:134029259-134029281 GTTCTCCCCACCCCACTGTCTGG - Intergenic
1170849950 20:19995953-19995975 TTTCCCCCCACCTCCCCGTCAGG + Intronic
1174136154 20:48381474-48381496 GTTCAGGCCATCACACCGTCAGG - Intergenic
1175359426 20:58396647-58396669 GTGCCCCCCAACACCCCGTTGGG + Intronic
1177291199 21:19114215-19114237 GTTCTCTTCAGCACACCCTCGGG + Intergenic
1183817206 22:40312573-40312595 GTACCCCCCAGCACACTTCCTGG - Exonic
1184407887 22:44310401-44310423 GTCGCCCCCAGCACCCTGTCTGG - Intronic
1185373421 22:50471147-50471169 GTGCCACCCAGCACACCGTTTGG - Intronic
952335401 3:32399433-32399455 ACTCCCCCCAGCACCCAGTCTGG - Intronic
952861754 3:37818613-37818635 GTATTCCCCAGCACACAGTCTGG + Intronic
953025347 3:39141902-39141924 GTTCCCACAAGCACACAGGCTGG + Exonic
961231135 3:125310910-125310932 GTTACCCCCAGCAAACAGGCTGG + Intronic
966378774 3:179323137-179323159 GGTCGGCCCAGCACAGCGTCCGG + Intronic
966928865 3:184662907-184662929 GTTCCCCCCAGCACACCGTCGGG - Intronic
968481831 4:836734-836756 GTCCCTCCCAGCACACTGCCTGG + Intergenic
985881471 5:2641822-2641844 GTTCCTCCCAGCAGACCACCTGG + Intergenic
997472991 5:134127127-134127149 GGTACCCCCAGCACACTGTCAGG + Intronic
997668522 5:135651361-135651383 GTTTCCCCCAGGACTCCCTCAGG + Intergenic
1002662926 5:180803270-180803292 TTTCCCCCCGGCCCCCCGTCGGG - Intronic
1006229124 6:32567200-32567222 ATTGCCCTCAGCAAACCGTCTGG + Intronic
1007734007 6:43969195-43969217 TTTCCCCCAAGCACACAGCCAGG - Intergenic
1017939608 6:159040273-159040295 CTGCCCCCCACCACACTGTCTGG + Intronic
1018739154 6:166714155-166714177 GTTACCCCCAGCACGCTGTGGGG + Intronic
1018851698 6:167644965-167644987 GTGGCGCCCAGCACACCCTCCGG - Intergenic
1019569431 7:1703905-1703927 AAACCCCCCAGCACACAGTCCGG - Intronic
1021139303 7:17004021-17004043 GTTCCACCCAGCCCACAGGCAGG + Intergenic
1024302318 7:47896643-47896665 CCTCCCCCCAGCACACAGCCAGG + Intronic
1024578166 7:50781647-50781669 GGTCCCCCCAGCACCCTGGCAGG + Intronic
1030291954 7:107881458-107881480 ATTCCCCCCAACCCACCCTCTGG + Intergenic
1032391367 7:131556959-131556981 GGATCCCCCAGCACACCGCCGGG + Intronic
1032787322 7:135211299-135211321 CTTCCCCCCAGCACTGCCTCCGG - Intronic
1036790161 8:11711944-11711966 GCTCCTCCCACCACACTGTCTGG - Intronic
1037535699 8:19821771-19821793 GTTCAGCCCAGCACACTTTCTGG + Intronic
1038098035 8:24337520-24337542 GTGCCTCCCAGCACAGTGTCTGG + Intronic
1040560417 8:48518645-48518667 CTTTCCCTCAGCACACCCTCTGG - Intergenic
1041644513 8:60237855-60237877 CTTCCCCCCAGCCCACCAACAGG + Intronic
1044926880 8:97216896-97216918 GTTCCCCACAACACATTGTCTGG - Intergenic
1048124172 8:131614510-131614532 GTTGCCCCCAGCACAGCTTGGGG - Intergenic
1057053223 9:91941631-91941653 TTTCCCTCCAGCACAGGGTCAGG + Intronic
1058764707 9:108170272-108170294 GTTCCCCCCAGCAATACATCAGG - Intergenic
1060441387 9:123643112-123643134 CTCCCCACCAGCACACAGTCTGG - Intronic
1061192097 9:129087975-129087997 CTTGCCCCCAGCACACAGCCTGG - Intronic
1189206271 X:39241796-39241818 GTGCCCCCCACCATACCTTCTGG - Intergenic
1189587018 X:42472196-42472218 CTTCCCCCTACCTCACCGTCTGG - Intergenic
1195329190 X:103782904-103782926 TTTCTCCCCAGCACAGGGTCAGG - Intronic
1199577183 X:149323697-149323719 GTGGCCCCCAGCCCACAGTCAGG + Intergenic
1199977429 X:152902648-152902670 GATCCCCCCAGCACCCAGCCTGG + Intergenic