ID: 966930463

View in Genome Browser
Species Human (GRCh38)
Location 3:184672425-184672447
Sequence CCATCCAACACGTGGTAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 46}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966930463_966930467 -8 Left 966930463 3:184672425-184672447 CCCACTTACCACGTGTTGGATGG 0: 1
1: 0
2: 1
3: 2
4: 46
Right 966930467 3:184672440-184672462 TTGGATGGATGCGTCCATTAAGG 0: 1
1: 0
2: 0
3: 2
4: 53
966930463_966930470 1 Left 966930463 3:184672425-184672447 CCCACTTACCACGTGTTGGATGG 0: 1
1: 0
2: 1
3: 2
4: 46
Right 966930470 3:184672449-184672471 TGCGTCCATTAAGGATGGGATGG 0: 1
1: 0
2: 0
3: 5
4: 75
966930463_966930469 -3 Left 966930463 3:184672425-184672447 CCCACTTACCACGTGTTGGATGG 0: 1
1: 0
2: 1
3: 2
4: 46
Right 966930469 3:184672445-184672467 TGGATGCGTCCATTAAGGATGGG 0: 1
1: 0
2: 1
3: 4
4: 55
966930463_966930471 5 Left 966930463 3:184672425-184672447 CCCACTTACCACGTGTTGGATGG 0: 1
1: 0
2: 1
3: 2
4: 46
Right 966930471 3:184672453-184672475 TCCATTAAGGATGGGATGGATGG 0: 1
1: 1
2: 2
3: 11
4: 182
966930463_966930468 -4 Left 966930463 3:184672425-184672447 CCCACTTACCACGTGTTGGATGG 0: 1
1: 0
2: 1
3: 2
4: 46
Right 966930468 3:184672444-184672466 ATGGATGCGTCCATTAAGGATGG 0: 1
1: 0
2: 1
3: 7
4: 92
966930463_966930473 13 Left 966930463 3:184672425-184672447 CCCACTTACCACGTGTTGGATGG 0: 1
1: 0
2: 1
3: 2
4: 46
Right 966930473 3:184672461-184672483 GGATGGGATGGATGGAGTACAGG 0: 1
1: 0
2: 2
3: 41
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966930463 Original CRISPR CCATCCAACACGTGGTAAGT GGG (reversed) Intronic
908857483 1:68446767-68446789 CCATCAAACAGGTGGTAAAATGG + Exonic
910707688 1:90147030-90147052 TCATCCAACACCAGGTATGTGGG + Intergenic
1069553280 10:69379750-69379772 CCATCCCACACATGGTAAGTGGG + Intronic
1070941493 10:80352446-80352468 CCATGGAACAACTGGTAAGTAGG - Exonic
1074569798 10:114614149-114614171 CCTTCCAACACTTGGAAAGTAGG + Intronic
1075654484 10:124152237-124152259 TCAGCCAAGGCGTGGTAAGTTGG + Intergenic
1075912824 10:126140819-126140841 CCATGCATCACGTGGTTGGTTGG + Intronic
1079501161 11:21102715-21102737 CCATGCAAAAGGTGGGAAGTAGG - Intronic
1080909067 11:36576538-36576560 CCATCCAAGAGGTGGTAGGTTGG + Exonic
1088080539 11:105906650-105906672 CCAGCTAATACGTGGTAAGCTGG + Intronic
1095573834 12:43712111-43712133 CCATCCATGACAGGGTAAGTGGG - Intergenic
1096171844 12:49477869-49477891 TCCTCCAATAAGTGGTAAGTTGG + Intronic
1104899124 12:132178782-132178804 CCACCCTACACGTGTAAAGTGGG - Intergenic
1108462251 13:50678305-50678327 CCATCCACTACTTGGTAAGCAGG - Intronic
1115471757 14:33775283-33775305 CCTTCCCACACCTGGTATGTGGG - Intronic
1127961289 15:63892835-63892857 CCACCCGGCACATGGTAAGTGGG + Intergenic
1135838595 16:25852054-25852076 CCATCCAAAACTGGGTGAGTAGG + Intronic
1141063204 16:80893894-80893916 CCCTCCAACACTTGGTCTGTAGG - Intergenic
1154012336 18:10586226-10586248 TCATCCAATACTTGCTAAGTGGG + Intergenic
1161314426 19:3611252-3611274 CCAGCCAGCACGGGGTGAGTTGG + Exonic
1162074301 19:8174866-8174888 TCATCCACCACGTGGTATGCGGG + Intronic
1164875861 19:31687949-31687971 CCACCCATCACGGGGGAAGTAGG - Intergenic
928545459 2:32325357-32325379 ACTTCCAACAAGTGGTAGGTTGG + Intergenic
932672775 2:73752669-73752691 CCATCAGACATGTGGAAAGTAGG + Intergenic
1171275324 20:23852003-23852025 CCATCCAGCAGGTGGTGAATGGG - Intergenic
1182887483 22:33787769-33787791 CCCTTCAACACTTGGTAAGAAGG + Intronic
1184212941 22:43047343-43047365 CCTTCCAACACATGGAAAGGTGG + Intronic
949408758 3:3741526-3741548 CGATCCATCACGTGGAAACTTGG - Intronic
950644656 3:14369816-14369838 CCATCCAACAGGTGGCAGGAGGG - Intergenic
957134977 3:76275053-76275075 CCATCTAAAATGTGGTGAGTTGG - Intronic
966930463 3:184672425-184672447 CCATCCAACACGTGGTAAGTGGG - Intronic
970337119 4:15059809-15059831 CCATCTAACAAGTGCAAAGTGGG - Intronic
977243108 4:94597940-94597962 CTATCCAAAATGTGTTAAGTTGG - Intronic
985275341 4:188232969-188232991 CCTTCCAACAATTGCTAAGTGGG - Intergenic
997420434 5:133762827-133762849 CCCTCCAGCAAGTGGGAAGTGGG + Intergenic
1008222784 6:48875421-48875443 CCATCCACCAGGTTTTAAGTTGG - Intergenic
1008406959 6:51128946-51128968 GCATCAAACAAGTGGTATGTTGG - Intergenic
1024060268 7:45692286-45692308 CCATCCAACAGGTGCTTATTGGG + Intronic
1028953647 7:96665026-96665048 CAATCCCACACGTGTTCAGTGGG + Intronic
1038403999 8:27308511-27308533 CCCTCCACCACTTGGTAAGAAGG - Intronic
1039137313 8:34339851-34339873 CCATCCAACATCTGCTCAGTGGG + Intergenic
1043098178 8:76002873-76002895 CAACCCAACATGTGGTATGTAGG + Intergenic
1048406706 8:134129918-134129940 CCATCTCACATGTGGAAAGTAGG - Intergenic
1051811470 9:21054405-21054427 CAATCCAGCACAGGGTAAGTGGG + Intergenic
1053533041 9:38900487-38900509 GCATCCGACACATGGTCAGTTGG + Intergenic
1054205267 9:62124916-62124938 ACATCCGACACATGGTCAGTTGG + Intergenic
1054633094 9:67463454-67463476 GCATCCGACACATGGTCAGTTGG - Intergenic
1056397742 9:86196932-86196954 CCATGCTACACAGGGTAAGTAGG - Intergenic
1056689275 9:88792841-88792863 CCACACAACACCTGGTAAGGAGG + Intergenic
1057555727 9:96086046-96086068 CTAGCCAACACGTGGTAACATGG + Intergenic