ID: 966930752

View in Genome Browser
Species Human (GRCh38)
Location 3:184674052-184674074
Sequence CCACCTGGACTGGAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 319}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966930742_966930752 17 Left 966930742 3:184674012-184674034 CCCAAGAAGTTCCTGTACCAGGA 0: 1
1: 0
2: 0
3: 20
4: 128
Right 966930752 3:184674052-184674074 CCACCTGGACTGGAGCAGGAAGG 0: 1
1: 0
2: 4
3: 29
4: 319
966930743_966930752 16 Left 966930743 3:184674013-184674035 CCAAGAAGTTCCTGTACCAGGAG 0: 1
1: 0
2: 2
3: 12
4: 179
Right 966930752 3:184674052-184674074 CCACCTGGACTGGAGCAGGAAGG 0: 1
1: 0
2: 4
3: 29
4: 319
966930745_966930752 0 Left 966930745 3:184674029-184674051 CCAGGAGTTCTTCCTAAAGAAAC 0: 1
1: 0
2: 0
3: 25
4: 219
Right 966930752 3:184674052-184674074 CCACCTGGACTGGAGCAGGAAGG 0: 1
1: 0
2: 4
3: 29
4: 319
966930744_966930752 6 Left 966930744 3:184674023-184674045 CCTGTACCAGGAGTTCTTCCTAA 0: 1
1: 0
2: 0
3: 6
4: 97
Right 966930752 3:184674052-184674074 CCACCTGGACTGGAGCAGGAAGG 0: 1
1: 0
2: 4
3: 29
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966930752 Original CRISPR CCACCTGGACTGGAGCAGGA AGG Intronic
900001235 1:15939-15961 CTCCCTGGACTGGAGCCGGGAGG + Intergenic
900270288 1:1783564-1783586 GCACCTTGCCTGGAGCAGGGCGG + Intergenic
900520445 1:3102836-3102858 GCATCTGCTCTGGAGCAGGAAGG - Intronic
900974951 1:6011191-6011213 CCACGTGCACAGGAGCAGGAGGG + Intronic
901183342 1:7356681-7356703 CCACCAGGAATGGGGCAGGCTGG - Intronic
901420127 1:9145143-9145165 CCACCCGGGCTGGTGCAGGATGG + Intergenic
901480468 1:9521475-9521497 CCATCTGGACTCAAGAAGGAAGG - Intergenic
901760431 1:11467674-11467696 TCACATGGCCTGAAGCAGGAGGG + Intergenic
902229470 1:15018782-15018804 CCACCTGGACTGGCACAGGCGGG + Intronic
902437832 1:16409650-16409672 GGACCTGGGCTGGAGAAGGATGG - Exonic
902660979 1:17903599-17903621 CCACCTGAAGTGGACTAGGAAGG - Intergenic
903064108 1:20688923-20688945 CCCCCTGAACTGGAGCACTAAGG - Intronic
903141892 1:21344260-21344282 GCGCCTGGATGGGAGCAGGATGG - Intronic
903165154 1:21515046-21515068 CAAGCTGGAGTGGAGGAGGAGGG - Intronic
903510825 1:23873800-23873822 CCACCAGGACTGCTGCTGGAAGG + Exonic
904207624 1:28865014-28865036 ACAGCTGGGCTGGAGCAGGTGGG - Intergenic
904271779 1:29354908-29354930 CCACCAGGACTGGGTCAGGCGGG - Intergenic
905900960 1:41581710-41581732 CCACTGGGGCTGGAGCAGAAGGG + Exonic
906082575 1:43102787-43102809 TCACTTGGACTGCAGCAGGGAGG - Intergenic
906609725 1:47192898-47192920 ACAGCTGGGCTGGAACAGGAAGG - Intergenic
906782011 1:48580991-48581013 CCAGCTGGGGTGGTGCAGGAGGG - Intronic
907458944 1:54593922-54593944 CCACCTGGAGAGGAACAGTAAGG - Exonic
907633416 1:56107353-56107375 CCACCTGCACTAGAGCAGGTGGG + Intergenic
907766926 1:57422260-57422282 CCAGCAGGAAGGGAGCAGGAAGG + Intronic
911498772 1:98661535-98661557 CCACCTGGCCTGGGGCGGGCTGG - Intergenic
911685019 1:100765563-100765585 CCAGAGGGACTGGAGCAGAAGGG + Intergenic
912496048 1:110092363-110092385 AGACATGGACTGGACCAGGAGGG - Intergenic
914997728 1:152559471-152559493 CCACCTTCCCTGGAACAGGATGG + Intronic
915048348 1:153039926-153039948 CCACCTGGACAGTGGCAGTATGG + Exonic
915049745 1:153056315-153056337 CCACCTGGACAGTGGCAGTATGG + Exonic
915050794 1:153070419-153070441 CCACCTGGACAGTGGCAGTATGG + Exonic
915054331 1:153112313-153112335 CCACCTGGACAGTGGCAGTATGG + Exonic
915056754 1:153140289-153140311 CCACCTGGACAGTGGCAGCATGG + Intergenic
915568960 1:156733539-156733561 CGACCTGGACTGCAGGAGCAGGG + Intronic
915734853 1:158078267-158078289 CTACCTGGACTTGAGCATTAGGG - Intronic
916712876 1:167427499-167427521 CCTCCTGGAGTGCAGGAGGAAGG - Intergenic
916962210 1:169900260-169900282 GCACCAGGAGTGTAGCAGGAAGG - Intergenic
918466859 1:184829504-184829526 TCACCTGGGCTGGAGTAGGGTGG + Intronic
919077605 1:192831763-192831785 CCAACTGGACAGGAGAAGGTCGG + Intergenic
919765844 1:201126998-201127020 CCACCCGGCCTGGAGGAGGGAGG - Intronic
919809410 1:201399364-201399386 CCACCTGGGCTGGAAGGGGAGGG - Exonic
920048682 1:203150300-203150322 GCACATGCAGTGGAGCAGGAGGG + Intronic
920080391 1:203368768-203368790 CCACCTGCACAGGACCAGGATGG + Intergenic
920346902 1:205311948-205311970 CCACCTACACTGGTGAAGGATGG - Intronic
920385485 1:205568334-205568356 CCACCTGGCCAGGTGCGGGAAGG - Intergenic
920977387 1:210798697-210798719 TCACCTGGACAGCTGCAGGAGGG - Intronic
921634431 1:217476306-217476328 GCACCTGGGGTGGAGCAAGATGG + Intronic
1065369927 10:24973393-24973415 CCAGGTGGGATGGAGCAGGACGG + Intergenic
1065771514 10:29082621-29082643 ACAGCTGGACTGGACCAGGTTGG - Intergenic
1066998388 10:42584119-42584141 TCAGGTGGACTGGTGCAGGATGG - Intronic
1067189042 10:44054465-44054487 CCACCTGGGCAGCAGCAGGGAGG - Intergenic
1069509935 10:69034686-69034708 CAGCCCGGACTGGAGTAGGAAGG - Intergenic
1072854925 10:98936517-98936539 CTACCTTGACTGGAGAAGGGAGG + Intronic
1076734189 10:132451444-132451466 CCACCTGGCCTGGAGCACGCAGG + Intergenic
1077181933 11:1220691-1220713 CAGCCTGGCCTGGAGCAGGCAGG + Intergenic
1077536109 11:3125056-3125078 CCACCTGGCCTGCAGGAGGGAGG - Intronic
1077550242 11:3196993-3197015 CCACCTGGAGTGGCACAGGGAGG + Intergenic
1077560655 11:3258280-3258302 CCACCTTGCCTGGCACAGGAGGG - Intergenic
1077566551 11:3304108-3304130 CCACCTTGCCTGGCACAGGAGGG - Intergenic
1077905485 11:6529696-6529718 CCACCTGTACTGGGGAAGGCCGG + Intronic
1078681327 11:13479526-13479548 CCCCGTGGACTTGAGAAGGAAGG + Intergenic
1078877155 11:15410327-15410349 TCAGATTGACTGGAGCAGGAGGG + Intergenic
1079317464 11:19421250-19421272 GAACCTGGACTGCAGCAGGTGGG - Intronic
1080571993 11:33565177-33565199 CCACCTGGAAGGCAGCAGAAAGG - Intronic
1080578391 11:33621210-33621232 GCACCAGGACTGTAGCAGCATGG + Intronic
1080590796 11:33721698-33721720 ACAGATGGCCTGGAGCAGGAGGG + Intronic
1081346595 11:41994891-41994913 CCTACAGGGCTGGAGCAGGAGGG + Intergenic
1081695553 11:45106703-45106725 CCACGTGGAGTGGAGCAGATGGG - Intronic
1081976633 11:47239519-47239541 CCCCTTCAACTGGAGCAGGACGG - Exonic
1082804416 11:57438473-57438495 ACACCTGGGCTGCAGCAAGAAGG + Intergenic
1083304617 11:61755918-61755940 CCACCAGGGCTGGAGGAGGGAGG + Intronic
1083686956 11:64382325-64382347 CCCACTGGGCTGCAGCAGGAGGG - Intergenic
1085470422 11:76754021-76754043 GCAACTGGACAGGCGCAGGATGG - Intergenic
1085645936 11:78222932-78222954 CGACCTGGCCAGGAGCAGCAGGG - Intronic
1085828981 11:79879320-79879342 CCATCTGGCCTGGAGGAAGAGGG + Intergenic
1086143559 11:83525653-83525675 CCCCCTGGAGTGCAGCAGTATGG + Intronic
1089169111 11:116500161-116500183 CCTGCTGGCCTGGAGAAGGACGG - Intergenic
1089775327 11:120831776-120831798 ACACCTGGGCAGAAGCAGGAAGG - Intronic
1091374326 12:16057-16079 CTCCCTGGACTGGAGCCGGGAGG + Intergenic
1091700409 12:2655220-2655242 CCACCTGAAGAGGAGCAGCACGG - Exonic
1091996376 12:4997368-4997390 CCCTCAGGTCTGGAGCAGGAAGG - Intergenic
1092022504 12:5214271-5214293 TTACCTGGACTGGAGTGGGAAGG + Intergenic
1092308831 12:7330746-7330768 CCACTTGGACTTCAGCATGAAGG - Intergenic
1092528875 12:9327823-9327845 CCAGCTGGAGTGAAGCAGTACGG + Intergenic
1093044987 12:14433079-14433101 CCACCTCGACTGGCCCAGAAGGG - Intronic
1093434339 12:19118459-19118481 CTACCAGAACTGGAGGAGGAAGG + Intergenic
1094656133 12:32420930-32420952 TCACCTGGACTGGAGTATGGTGG + Intronic
1094671023 12:32569423-32569445 CCAGCAGGATTGGAGCAGAATGG - Intronic
1095089049 12:38087191-38087213 CCACCTGGGCTGGGGCTGTAGGG + Intergenic
1096576267 12:52554686-52554708 CCTCCTGGAGGAGAGCAGGATGG - Intergenic
1096828076 12:54294611-54294633 CCAGCTGGGCTGGAGCAGGGTGG - Intronic
1097221649 12:57454787-57454809 CCACCTGGGCCTGAGCAAGAGGG + Intronic
1098633701 12:72755871-72755893 CCATTTGGACTGGAGTAAGATGG - Intergenic
1098811837 12:75104297-75104319 CCAAGTAGAATGGAGCAGGATGG + Intronic
1099831946 12:87855289-87855311 CCACCTGGGCTGGAGTACAATGG - Intergenic
1101022554 12:100567965-100567987 CCATCAGCACTGGGGCAGGAGGG - Intergenic
1101376742 12:104177898-104177920 CCACCAGGGCTGTAACAGGAGGG - Intergenic
1101403312 12:104406983-104407005 ACAACTGGAGTGGAGTAGGAGGG + Intergenic
1101784965 12:107874761-107874783 CCCCAGGGACTAGAGCAGGAAGG + Intergenic
1101793236 12:107949759-107949781 GGACCTGAACTGGAGCAGGGTGG + Intergenic
1101815894 12:108146009-108146031 TTACCTCGACTGGAGAAGGAGGG + Intronic
1102599743 12:114020784-114020806 CCACCTGGACAAATGCAGGAGGG - Intergenic
1102636870 12:114332381-114332403 CCACCTGGATTCAAGAAGGAAGG - Intergenic
1102936259 12:116899578-116899600 TAACCTGGTCTGGAGAAGGAAGG + Intergenic
1103454443 12:121053807-121053829 CTTCCTGGACTGGACCTGGAGGG + Intergenic
1104146026 12:126034680-126034702 CCAACAGGCCTGAAGCAGGAAGG - Intergenic
1105225768 13:18430136-18430158 CCAACAGGACTAGAGCACGAGGG - Intergenic
1106477371 13:30110216-30110238 CCCGCTGGACTGCAGCATGATGG + Intergenic
1107556357 13:41519582-41519604 TCACCTTGACTGTAGAAGGAGGG + Intergenic
1108245951 13:48514314-48514336 CCAGCTGGGATGGAGCAAGATGG + Intronic
1113466597 13:110517786-110517808 CCACATGGGATGGGGCAGGAGGG + Intergenic
1113640238 13:111952159-111952181 CCAGCTGAGCTGCAGCAGGACGG + Intergenic
1114136541 14:19858339-19858361 ACACCTGGAGGGGAGCAGGAAGG + Intergenic
1114663788 14:24367196-24367218 TCACCTGGGCTGGAGGAGGAAGG - Exonic
1116939047 14:50771944-50771966 TCACCTGGACTGGAGTATAACGG - Intronic
1118329741 14:64805990-64806012 CCACCTGAACTGGTACAGCATGG - Intronic
1118784429 14:69034356-69034378 CCACCTGACCGAGAGCAGGAGGG + Intergenic
1121246475 14:92464593-92464615 CCTGCTGGACAGTAGCAGGAAGG + Intronic
1121466942 14:94121813-94121835 GCACCTGGACTGGGGGAGGGAGG + Intergenic
1121717310 14:96085418-96085440 CCTCCTGGGCTGGGGCAGGAAGG + Intronic
1121908969 14:97771684-97771706 CCAACTGGACTGAGACAGGAAGG - Intergenic
1122623125 14:103070927-103070949 CCACCAGGGCTGGTGCAGGAAGG + Intergenic
1123403195 15:20005582-20005604 CCATCTGGACTGGTACTGGAGGG + Intergenic
1123711356 15:22990119-22990141 CCATGTGGACTGCATCAGGAAGG - Intronic
1125757340 15:42072452-42072474 CCGCCAGGACAGGGGCAGGATGG + Intronic
1128809127 15:70557282-70557304 CCAAATGGACTGGAGTAGGAGGG - Intergenic
1130060842 15:80568883-80568905 CCACGTGGACTGGCTCAGCAGGG - Intronic
1132027891 15:98418251-98418273 CCTCCTGGCTTCGAGCAGGAAGG - Intergenic
1132116356 15:99138951-99138973 CCGTCAGGACTGGAGCCGGAAGG - Intronic
1132454623 16:15625-15647 CTCCCTGGACTGGAGCCGGGAGG + Exonic
1132751718 16:1460716-1460738 CCACCTGCACTGGAACACGCTGG + Intronic
1132847247 16:2006288-2006310 CCACAATCACTGGAGCAGGAGGG + Intronic
1132977974 16:2719968-2719990 CCACCTGCTCAGGGGCAGGAGGG + Intronic
1136029080 16:27489777-27489799 CCACCAGAGCTGCAGCAGGAAGG - Intronic
1136234701 16:28906218-28906240 CCTGCTGGGCTGGGGCAGGAGGG + Intronic
1136592052 16:31223446-31223468 CCACCTGCGCTGAGGCAGGAAGG - Intronic
1137547003 16:49411403-49411425 CCAGCTGGCCTGGAGCGGGTAGG - Intergenic
1137629754 16:49934664-49934686 TCATCTGGACTGTGGCAGGAGGG - Intergenic
1140347359 16:74227284-74227306 CCACCTGGACAGGACCAGCCTGG + Intergenic
1141377808 16:83548076-83548098 CCAGATAGATTGGAGCAGGAAGG + Intronic
1141557014 16:84842930-84842952 CCTCCCGGTCTGGAGCAGGCTGG + Intronic
1141611442 16:85183386-85183408 CCAGCTGGGCTGCACCAGGAAGG + Intronic
1142151775 16:88515679-88515701 CCCCGTGGCCTGGAGCAGGGAGG + Intronic
1142220104 16:88850104-88850126 CCACCTGGACTGGAGACAGCAGG - Intronic
1144088770 17:11834619-11834641 CCACCTGCATTGGAGAAGCACGG - Exonic
1144595227 17:16564238-16564260 TCACCTGGACTGGAGTGCGATGG + Intronic
1144951399 17:18996361-18996383 CCCCCTGGAGGGGAGGAGGAGGG - Intronic
1145866885 17:28247469-28247491 ACAGGTGGACAGGAGCAGGAGGG - Intergenic
1145894590 17:28446885-28446907 CCAGGTGGGATGGAGCAGGACGG - Intergenic
1146793450 17:35765669-35765691 CCATCTGGCCTGGAGCTGCAAGG + Intronic
1146846218 17:36183407-36183429 CCAGCTGTCCTGGAGCAGAAAGG + Intronic
1146891226 17:36507721-36507743 GAACCTGGACTGGGGCTGGAAGG + Intronic
1147110121 17:38256277-38256299 GCCCCTGGGCTGGAGCAGGCGGG + Intergenic
1147241178 17:39091426-39091448 ACTCCTGCACTGGAGCCGGATGG + Intronic
1147998426 17:44374357-44374379 CCACATGGCCAGGACCAGGATGG + Exonic
1148419392 17:47532144-47532166 GCCCCTGGGCTGGAGCAGGCGGG - Intronic
1148596730 17:48862354-48862376 TCCCATGAACTGGAGCAGGAAGG - Intronic
1148894054 17:50829890-50829912 TCACCTAGGCTGGAGCATGATGG + Intergenic
1151003857 17:70411233-70411255 CCACTTGGAGTGGAACAGAAAGG - Intergenic
1151448082 17:74180444-74180466 AGACCTGGGCTGGGGCAGGATGG + Intergenic
1151555529 17:74844651-74844673 CCAGCCTGGCTGGAGCAGGATGG + Intronic
1151740695 17:75979727-75979749 CCACCCGGATTGGAGAAGAATGG + Intronic
1151789063 17:76292388-76292410 CAACCTGGAGTGGATCAGCATGG - Exonic
1152029017 17:77830374-77830396 CGACCTGGGCGTGAGCAGGAGGG + Intergenic
1152102868 17:78313217-78313239 CGACCTGGCCTGCAGCGGGACGG - Intergenic
1152944276 17:83190668-83190690 CCACCGGGAGAGGAGCAGCACGG - Intergenic
1153129098 18:1834284-1834306 CCTCCTGGAAGGGAGCAAGATGG + Intergenic
1153711997 18:7809475-7809497 GCACCTGGGCTGGAGAAGAAGGG - Intronic
1153938431 18:9953278-9953300 GCACCTGGACTGGAAAATGAGGG - Intronic
1154460812 18:14583348-14583370 ACACCTGGAGGGGAGCAGGAAGG + Intergenic
1154527608 18:15309385-15309407 CCAACAGGACTAGAGCACGAGGG + Intergenic
1155453441 18:25986636-25986658 GCACCTGGAGACGAGCAGGACGG - Intergenic
1156449457 18:37258818-37258840 CCACCTTGACAGGGGTAGGAGGG - Intronic
1156460464 18:37318879-37318901 CCATCTGGTGTGGAGCAGGCAGG - Intronic
1159115091 18:64104885-64104907 CCACAGGGCCTGGAGGAGGAAGG - Intergenic
1160005561 18:75066443-75066465 CACCCTGGACTGCAGCAGAAAGG - Intergenic
1160563475 18:79772825-79772847 CCAGCTGGAAAGCAGCAGGAAGG + Intergenic
1163632985 19:18426535-18426557 GCAGCTGGACTGGAGCGGGGTGG + Intronic
1164485345 19:28650970-28650992 TAACCTGGACAGGAGCAGTAGGG - Intergenic
1165046563 19:33109175-33109197 TCACCTGGACTGGAGTACGGTGG - Intronic
1166239629 19:41481049-41481071 GCAGCTGGTCTGGAGCAGGAGGG + Intergenic
1166482830 19:43187728-43187750 CCCCCTGGGCTGCAGCAGGCAGG + Intronic
1167006081 19:46777461-46777483 TCACCTGGGCTGGACCTGGAGGG - Intronic
1167516719 19:49927840-49927862 CCACCTCGGCTGGTGGAGGAGGG + Exonic
925399127 2:3558911-3558933 CCACGTGCAGTGGAGCAGGGAGG - Intergenic
925748179 2:7062662-7062684 CCACTGATACTGGAGCAGGATGG + Intronic
925768123 2:7257582-7257604 CCCCCTGGGCTGAAGCAGGCAGG - Intergenic
926723973 2:15983377-15983399 CCACCTGCTCTGAAGCAGGAAGG + Intergenic
927653521 2:24926976-24926998 CCACCAGGGCTGCAGCAGAATGG - Intergenic
927667050 2:25040252-25040274 AGACTTGAACTGGAGCAGGAAGG - Intergenic
928330224 2:30351980-30352002 CAACCTGCACTGGGGCCGGAGGG + Intergenic
934860047 2:97757202-97757224 TCAGCTGGACTGGAGGTGGAGGG + Exonic
936157062 2:110054649-110054671 GCACCTAAAATGGAGCAGGAAGG + Intergenic
936187632 2:110316795-110316817 GCACCTAAAATGGAGCAGGAAGG - Intergenic
936568486 2:113597472-113597494 CTCCCTGGACTGGAGCCGGGAGG - Intergenic
937070059 2:119056523-119056545 CTACCTGAAGTGAAGCAGGAAGG + Intergenic
937151614 2:119690260-119690282 CCTACACGACTGGAGCAGGAAGG - Intergenic
937863332 2:126730325-126730347 GCACCTGCGCTGGAGCTGGATGG - Intergenic
938442616 2:131349824-131349846 TCACCTGGGCTGGAGTAGGGTGG + Intronic
938526704 2:132140842-132140864 CCAACTGGACTAGAGCATGAGGG + Intergenic
939161091 2:138589703-138589725 CCAGCTGGGCTGGAGTGGGATGG + Intergenic
939458428 2:142467467-142467489 CCATCTGGCATGGACCAGGAGGG + Intergenic
940835350 2:158515254-158515276 GCACCTGGCCTGGAGTAGGCTGG + Intronic
942625674 2:177897560-177897582 CAAACTGGACTCGAGCAGAATGG - Intronic
943689311 2:190852891-190852913 CCTCATGCCCTGGAGCAGGAGGG + Intergenic
944115761 2:196184588-196184610 CCACTGGGACAGGAGGAGGAAGG + Intergenic
944476353 2:200110674-200110696 CCAGCTAGACTGTGGCAGGATGG - Intergenic
946637484 2:221745631-221745653 CTTCCTGGACTAGAGCAGGAGGG + Intergenic
947274442 2:228374174-228374196 ACTCCTGGACTGCAGCAGAACGG - Intergenic
947371600 2:229452316-229452338 CCACTTGGACTGTAGAAGAATGG + Intronic
947747019 2:232513071-232513093 CTACCAGGCATGGAGCAGGAAGG - Intergenic
948372179 2:237496343-237496365 AAGCCTGGACTGGAGCAGGGCGG - Intronic
1168847648 20:956521-956543 CTAGCAGGACTGGAGCAGGGTGG - Intergenic
1168870709 20:1125839-1125861 CCACCTGGAATTAAGAAGGAGGG + Intronic
1169423658 20:5479583-5479605 CCACCCAGGCTGGAGCATGATGG - Intergenic
1170051721 20:12153185-12153207 CCAGGTGGAATGGAGCAGGAGGG + Intergenic
1170566378 20:17610172-17610194 CCAGCTGGACTGCAGCTGGAAGG + Intergenic
1170801538 20:19594313-19594335 CCACCTGGACTGTAGCTGCTTGG - Intronic
1171456477 20:25275450-25275472 CCACCTGTGATGGAGAAGGACGG + Intronic
1172026728 20:31953686-31953708 CCACCTGGTGTGGGGAAGGAGGG + Intergenic
1172173905 20:32960940-32960962 GCACCTGGCCTGGTGCAGGGTGG + Intronic
1172302526 20:33860084-33860106 TCACCTGGAATGGAGCGGCAGGG + Intergenic
1172791473 20:37508829-37508851 CCACCTGAACAGGAACTGGAAGG + Intronic
1172903380 20:38350897-38350919 CCACCTGCCCTGGACCCGGATGG - Exonic
1173522320 20:43709363-43709385 CCACCTGCCCTAGAGCAGGGGGG - Intronic
1173539197 20:43838636-43838658 TCCCCTGGACTGGACAAGGAGGG + Intergenic
1174766137 20:53255604-53255626 GAACTTGGGCTGGAGCAGGAAGG - Exonic
1174831870 20:53820727-53820749 AGACCTGGAGTGGAGCAAGATGG - Intergenic
1175871131 20:62210052-62210074 CCAGCAGGGCTGGAGCAGGGAGG - Intergenic
1176670414 21:9728816-9728838 CCACCTGGAATGAAGCAGGAAGG + Intergenic
1176769821 21:13059159-13059181 CCAACAGGACTAGAGCACGAGGG - Intergenic
1179152587 21:38821655-38821677 TCAGCTGGACTGGAGACGGATGG + Exonic
1179594792 21:42435529-42435551 CCACCCTGCCTGGAGCAGGTGGG - Intronic
1179725748 21:43340442-43340464 CCACCTGGCCTGGGACTGGACGG + Intergenic
1180180130 21:46115050-46115072 CCACCAGGACTGGAGAAGCCAGG - Intronic
1181341270 22:22182008-22182030 GGACCTGGACTTGAGCAGCAGGG + Intergenic
1182250056 22:28992880-28992902 CCACGTGGACTGGAGGAGTTGGG + Intronic
1183303269 22:37068992-37069014 ACACCTGGCCTGGAGAAGGGCGG - Intronic
1183429298 22:37756045-37756067 CCACGGGCACTGGGGCAGGAGGG + Intronic
1183442462 22:37830919-37830941 CCACCTGGACTGGCTCAGTGAGG - Exonic
1183632404 22:39041182-39041204 GCACCTGGGCTGGGGCAGGTGGG - Intronic
1184479737 22:44739303-44739325 CCTCCTGCCCTGGGGCAGGAGGG + Intronic
1185090919 22:48772713-48772735 ACACCTGGCCTGATGCAGGATGG - Intronic
1185240486 22:49740545-49740567 CCACGTGGCATGGAGCATGAGGG + Intergenic
1185245540 22:49771064-49771086 CCACCGGGACCGGAGCCGGCTGG - Intergenic
949183198 3:1159370-1159392 CAGACTGGAATGGAGCAGGATGG + Intronic
950666571 3:14499063-14499085 CCACCAGGACTTGAACAGGCGGG + Intronic
953187352 3:40651231-40651253 CCATCTGGACAGGAGGAGAAGGG + Intergenic
953644513 3:44741748-44741770 CCAGCTGGATTGGTGCAGAATGG + Intronic
953882060 3:46695729-46695751 CTGCCTGGGCTCGAGCAGGAAGG + Intergenic
955525900 3:59819542-59819564 GGACCAGGACTGGAGCAGGGTGG - Intronic
956225869 3:66957487-66957509 ACACTGGGGCTGGAGCAGGAGGG - Intergenic
959083529 3:101827689-101827711 AGACCTGGACTGGAGCCGCAGGG - Exonic
961134127 3:124494375-124494397 TCACCTGGAGTGGACCAGAAGGG + Intronic
961431263 3:126885195-126885217 CCACGTTGACTGGAGCTGGAAGG - Intronic
962411236 3:135143353-135143375 CCTCCAGGCCTGGAGGAGGATGG + Intronic
962423170 3:135246028-135246050 CCACCTGTCCTGGAACAAGAAGG - Intronic
964732553 3:159882878-159882900 CCTACTGGCCAGGAGCAGGAGGG - Intronic
966346941 3:178990517-178990539 CCTCCAGGCCTGTAGCAGGAGGG + Intergenic
966438792 3:179920241-179920263 CCACCTGGAAGGGAGCACGCTGG - Intronic
966930752 3:184674052-184674074 CCACCTGGACTGGAGCAGGAAGG + Intronic
967259855 3:187631383-187631405 CCACTTGAACTGGAGAACGAAGG - Intergenic
968034882 3:195539640-195539662 CCACCTGGGCTGGAGTACGGTGG - Intronic
969491994 4:7504821-7504843 CCAGCTAGACCAGAGCAGGAAGG - Intronic
969584223 4:8082786-8082808 CCTCCTGGACTTGAGAAGGGCGG - Intronic
971187685 4:24396197-24396219 ACACCTGCTCTGGAGCAGGTTGG - Intergenic
971447516 4:26766612-26766634 ACACCTGGACTGGAGACAGAAGG + Intergenic
972266439 4:37464547-37464569 ACATCTGGACTAGAGCAGAATGG + Intronic
972967938 4:44535514-44535536 CAACCTGGTCTGGGGCAGCAGGG + Intergenic
977496852 4:97786652-97786674 TACCCTGGAATGGAGCAGGATGG - Intronic
978776544 4:112511110-112511132 GCACCTGGACCAGAGCCGGATGG - Intergenic
980063496 4:128156256-128156278 CCAGCTGGACTGGTGGGGGAAGG - Intronic
981716364 4:147756596-147756618 CCAGGTGGGATGGAGCAGGATGG - Intronic
982234889 4:153243115-153243137 CCACCAGTAATGAAGCAGGAAGG - Intronic
985366272 4:189235926-189235948 CCACCTGGCTGGGAGCAGCATGG + Intergenic
985404359 4:189622724-189622746 CCACCTGGAATGAAGCAGGAGGG - Intergenic
985565971 5:617561-617583 CCACCGGGACAGGGTCAGGAGGG - Intronic
986480413 5:8181028-8181050 CCACCTGGTGAGGAGGAGGAAGG - Intergenic
986763740 5:10904022-10904044 CCACCTGCACAGGACCAGGCAGG + Intergenic
987924404 5:24321338-24321360 GCCCCTGGACTTGGGCAGGAGGG - Intergenic
988063743 5:26207218-26207240 TCACCTGCTCTGGGGCAGGATGG - Intergenic
988567402 5:32330213-32330235 CGAGCTGCACGGGAGCAGGAAGG - Intergenic
988579143 5:32453963-32453985 CCCCCTTGAGTGGAGCAGTAAGG + Intergenic
995468988 5:112480309-112480331 CCTCCTGGACAGGAACAGCAGGG + Intergenic
997363206 5:133308515-133308537 CCACCTTGTGTTGAGCAGGATGG - Intronic
997442689 5:133919792-133919814 CCAGGTGGGATGGAGCAGGACGG - Intergenic
997980281 5:138464386-138464408 CCACCTGGACTGGATAAAGGGGG + Intergenic
998874677 5:146587312-146587334 ACTCCTGGACGGGAACAGGAGGG - Intronic
999171458 5:149598920-149598942 CCCCTTGGCCTGGTGCAGGAAGG + Intronic
999264062 5:150255173-150255195 GCCCCTGCACTGGAGGAGGAAGG - Intronic
999274359 5:150319163-150319185 CCTCCTGGAATGCAGCTGGAGGG - Intronic
1000497319 5:162001184-162001206 CAACCTGGACTGAAAGAGGATGG - Intergenic
1001530215 5:172455992-172456014 CCTCTGGGGCTGGAGCAGGATGG - Intergenic
1005884908 6:30090017-30090039 GAACTTGGACTGGAGCAGCAGGG + Intergenic
1006365024 6:33610210-33610232 GCAGCTGTAATGGAGCAGGAAGG - Intergenic
1006531506 6:34659042-34659064 GCACCTGGCCTGGAGCATTAGGG + Intronic
1007073109 6:39050342-39050364 AAACCTGGCCTGGAGGAGGATGG - Intronic
1007371519 6:41429257-41429279 CCGCCTGGAAAGGAGGAGGAGGG + Intergenic
1008663836 6:53696804-53696826 CCATCTGGCCCTGAGCAGGAGGG - Intergenic
1009292688 6:61903917-61903939 CCAGCTTGACTGGGACAGGATGG - Intronic
1013431804 6:110062704-110062726 CCTCCTCGGCTGGTGCAGGAGGG + Intergenic
1013665397 6:112342448-112342470 CCACCTGTCCTGGATTAGGAGGG + Intergenic
1018040705 6:159919434-159919456 GCAGCTGGGCTGGAGGAGGAAGG - Intergenic
1018746352 6:166765059-166765081 CCACCTGCCCTGGAGCTGGCAGG - Intronic
1019595767 7:1857650-1857672 CCAGCTGGACAGGAGGAAGAGGG + Intronic
1019747958 7:2711075-2711097 CCACCTGGATCTGAGCTGGAGGG + Intronic
1019919848 7:4156595-4156617 TCACCTGGTCTTAAGCAGGACGG + Intronic
1020111908 7:5452199-5452221 CCATCTGCACTGGAGCGGGTGGG + Intronic
1023476146 7:40579847-40579869 CCACCTGGAGCAGAGTAGGATGG + Intronic
1023816115 7:43951265-43951287 CCACATGCACTGTAGCATGAGGG + Intronic
1023866655 7:44241630-44241652 CCCTCTGGGCTGGAGCAGGGGGG - Intronic
1023912078 7:44563383-44563405 CGCCCTGGGCTGAAGCAGGAAGG - Intergenic
1024613192 7:51084555-51084577 CCACCTCGCCTGTAGCACGAGGG + Intronic
1027516423 7:79147740-79147762 CCCCAGGGAATGGAGCAGGAGGG + Intronic
1031207764 7:118782637-118782659 CCAGTAGGACTGGAGCAGGATGG - Intergenic
1033006075 7:137564841-137564863 CCACCTGGAATGCAGCTGGCTGG + Intronic
1036662718 8:10718177-10718199 GGACCTGGACTGCAGCAGGAGGG + Intergenic
1037837737 8:22224151-22224173 CAGCCAGGACAGGAGCAGGAAGG + Intronic
1038426834 8:27469305-27469327 CCACCTGGACTGGAGGAGGGGGG + Intronic
1038472736 8:27838873-27838895 CCACCTGGCTTGGAGCAGGAAGG + Intergenic
1039426977 8:37494110-37494132 GCACCTGGACTGAAGAAGGGAGG - Intergenic
1039593133 8:38767582-38767604 CCACCTGGCAAGAAGCAGGAAGG - Intronic
1040295048 8:46144724-46144746 CCCCCTGGGCTGGCCCAGGAAGG - Intergenic
1043563885 8:81526350-81526372 CCATCTGAAAGGGAGCAGGATGG + Intronic
1048343356 8:133557360-133557382 CCTCCTGCACTAGAGCAGGCAGG - Intronic
1049884043 9:16053-16075 CTCCCTGGACTGGAGCCGGGAGG + Intergenic
1050377018 9:4984620-4984642 CAGCCTGGACTGGGGAAGGACGG + Intergenic
1051265911 9:15307704-15307726 CCACCTGGACTGTAGGTGGAAGG + Intergenic
1052970101 9:34372187-34372209 CCACCTGGGCTGGAACAGCACGG - Exonic
1053175045 9:35916437-35916459 CCACCTCGACACCAGCAGGAGGG + Intergenic
1055835987 9:80442489-80442511 CTACCAGGACTGGAGCAAGAGGG - Intergenic
1056291078 9:85144493-85144515 CCACCTGTGCTGGAGCAGGCTGG + Intergenic
1057240151 9:93400558-93400580 CCTCCTGGACCAGAGCAGGCAGG - Intergenic
1057444707 9:95105302-95105324 CGGCCTGGACGGGAGCAGGAGGG + Intronic
1057860990 9:98640685-98640707 CCCCCTGGAGAGGAGGAGGAGGG + Intronic
1058707269 9:107647877-107647899 CCACCTGCAGTGGAGGGGGATGG - Intergenic
1059157270 9:112001302-112001324 CCTCCTTGAGTGAAGCAGGACGG - Intergenic
1061164956 9:128916864-128916886 CCACCTGGACTTCAGCAGAGTGG + Exonic
1061601688 9:131674683-131674705 CCGTCTGAACTGGAGCAGGTGGG - Intronic
1061888204 9:133603730-133603752 CACCCTGGGCTGGAGCAGGCAGG - Intergenic
1062082569 9:134632068-134632090 CCGCCAGGACCGGAGCAGGCAGG + Intergenic
1062114223 9:134798984-134799006 CCCCCTGGATTGGAGCTGGAAGG - Intronic
1062491509 9:136807318-136807340 GCACCAGGGCTGGAGCAGGGAGG + Intronic
1062568201 9:137172574-137172596 CCTCCAGGGCTGGGGCAGGAAGG + Intergenic
1062621787 9:137426104-137426126 GTTCCTGGACAGGAGCAGGAGGG + Intronic
1062681886 9:137786630-137786652 CGACCAAGACTGGAGCTGGAGGG - Intronic
1186421939 X:9433392-9433414 CCACCTAGACTGGAAGAGGAGGG - Intergenic
1189355142 X:40304715-40304737 TCACGTGGACTGCAGCAAGATGG - Intergenic
1189543044 X:42012438-42012460 AGACCTGGACTGAAGGAGGATGG + Intergenic
1195885666 X:109635076-109635098 CCAACTGGCCTGGAGCTGCAGGG - Intronic
1196793237 X:119482785-119482807 GCACGTGGACTGGAAAAGGAAGG - Intergenic
1199758972 X:150890804-150890826 CCATCAGGACTGGAGGAGAAGGG + Intronic
1200401767 X:156024106-156024128 CTCCCTGGACTGGAGCCGGGAGG - Intergenic