ID: 966930892

View in Genome Browser
Species Human (GRCh38)
Location 3:184674806-184674828
Sequence CCCGGCTACACTGTGTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966930892_966930897 -4 Left 966930892 3:184674806-184674828 CCCCATCACACAGTGTAGCCGGG 0: 1
1: 0
2: 0
3: 8
4: 106
Right 966930897 3:184674825-184674847 CGGGAATTTCTCACCCTCAAAGG 0: 1
1: 0
2: 0
3: 5
4: 58
966930892_966930900 20 Left 966930892 3:184674806-184674828 CCCCATCACACAGTGTAGCCGGG 0: 1
1: 0
2: 0
3: 8
4: 106
Right 966930900 3:184674849-184674871 CTTTCAACCAAAAAAAAAAAAGG 0: 1
1: 2
2: 24
3: 558
4: 5580

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966930892 Original CRISPR CCCGGCTACACTGTGTGATG GGG (reversed) Intronic
900480548 1:2896054-2896076 CCCTGCCACACTTTGAGATGCGG - Intergenic
901622214 1:10597722-10597744 GCCAGCTCCACTGTGTGAAGAGG + Intronic
902329354 1:15723622-15723644 CCCAGCTACTCTGTGGGCTGAGG + Intronic
903218510 1:21855849-21855871 CCGGGCTGCACTGTGAGCTGTGG + Exonic
905093043 1:35445090-35445112 CCCAGCCACACTGCATGATGAGG - Intronic
907223183 1:52921859-52921881 CCCAGCTCCTCTGTGTGATTTGG + Intronic
908653062 1:66357689-66357711 CCCGTCTAGTCTGTTTGATGGGG - Intronic
914077935 1:144374221-144374243 TGCGGCTACACTGTGGCATGGGG - Intergenic
914101244 1:144592280-144592302 TGCGGCTACACTGTGGCATGGGG + Intergenic
914172844 1:145242756-145242778 TGCGGCTACACTGTGGCATGGGG - Intergenic
916075382 1:161197450-161197472 TCCGGCCACAGTGTGTGAAGGGG + Intronic
916119154 1:161512443-161512465 CAGGGCTCCACTGTGTGATGGGG - Intronic
916128913 1:161594102-161594124 CAGGGCTCCACTGTGTGATGGGG - Intronic
916138827 1:161675933-161675955 CAGGGCTCCACTGTGTGATGAGG - Intronic
921389432 1:214603997-214604019 CCCGGCTCGGCTGTGTAATGAGG + Intronic
1063747363 10:8899717-8899739 CCCAGCTACTCTGTAGGATGAGG - Intergenic
1065362248 10:24899451-24899473 CCCGGCTATACTGTTTGAGTGGG + Intronic
1067867512 10:49924828-49924850 CCCTGCTAAACTGTGTCTTGTGG + Intronic
1073615637 10:104992026-104992048 CCCTGCTGCCCTGTGTGAGGGGG + Intronic
1076317702 10:129554174-129554196 CACGGCTGCAGTGTGTGATGAGG - Intronic
1078823906 11:14907883-14907905 CCCGGCCACACTCAGTGAGGAGG + Intronic
1081972589 11:47210064-47210086 CCCAGCTACTCTGGGTGCTGAGG + Intergenic
1083404896 11:62449753-62449775 CCCGGCTCCACTATGTGACTGGG + Intronic
1084152927 11:67299638-67299660 CCCGGTCACACCGTGTGGTGGGG + Intronic
1084561880 11:69910058-69910080 CCTGGCCACACTGTGTGAGTGGG - Intergenic
1088170911 11:106995509-106995531 CCTGGCTAGCCTGTGTGATTTGG + Intronic
1090285769 11:125497456-125497478 CCCAGCTACACTGGAGGATGAGG + Exonic
1094195483 12:27744960-27744982 CCCCGCCTCACTGTGTGTTGTGG - Intronic
1096133761 12:49182336-49182358 CCCGGCTACTCTGGCTGCTGAGG + Intergenic
1096769988 12:53928912-53928934 CCAGGCTCCACTGTGTGAGGCGG + Intergenic
1100363705 12:93900202-93900224 CCCAGCTACACAGTGGGTTGAGG + Intergenic
1103507722 12:121453010-121453032 CCCGGCTTCTCTGTGTGCGGAGG + Intronic
1107481890 13:40791986-40792008 CACGGCTCCTCAGTGTGATGAGG + Intronic
1111245977 13:85541690-85541712 CCTTGCTACTCTGTTTGATGTGG - Intergenic
1113170968 13:107502932-107502954 GCTGGATACACTGTGGGATGTGG - Intronic
1113766242 13:112882587-112882609 CCCGCCTGCCCTGTGTGTTGGGG + Exonic
1123699616 15:22904396-22904418 CCAGGCTGCACTGTCCGATGTGG + Intronic
1130728731 15:86467684-86467706 CCCTGAAATACTGTGTGATGAGG - Intronic
1130799644 15:87249352-87249374 CCTGGGTATACTGTGTGATACGG + Intergenic
1132228937 15:100167545-100167567 CCGGGCTGCACTGTGTGCTGTGG + Intronic
1135736513 16:24935922-24935944 CCCGGCTACTCAGGGTGCTGAGG - Intronic
1140812690 16:78593534-78593556 CCCGGCCACAGTGCATGATGGGG + Intronic
1141151348 16:81566437-81566459 CCATGCTACACTGGGTGAGGAGG + Intronic
1142631237 17:1228280-1228302 CCAGGCTGCTCTGTGTGTTGGGG - Intronic
1143289306 17:5816871-5816893 CCCGCCTACACTGCCTAATGAGG - Intronic
1144498160 17:15763458-15763480 CCCGTTTACACTGTGCAATGTGG + Intergenic
1148575346 17:48706593-48706615 GCCTGCTAGACTGTGAGATGAGG - Intergenic
1160991197 19:1860998-1861020 ACCGTCTACCCTGTGTGGTGGGG - Intronic
1161559820 19:4966690-4966712 CCCAGCTACACTGGGGGCTGAGG - Intergenic
1164114343 19:22203122-22203144 TCAGGCTTCACTGTCTGATGTGG - Intergenic
1164198487 19:22994965-22994987 TCAGGCTTCACTGTCTGATGTGG - Intronic
1167642206 19:50688076-50688098 CTCGTCTACTCTGTGTGATCTGG - Intronic
1168570915 19:57468406-57468428 CCCGGCTACTCAGGATGATGAGG + Intronic
925002747 2:419091-419113 CATAGCTACACTGTGTCATGGGG - Intergenic
925999949 2:9322709-9322731 CCTGGCTTCACTGAGTGAGGAGG + Intronic
926028751 2:9567319-9567341 CCCTGCTACTCTGTGGGCTGAGG - Intergenic
927754432 2:25697456-25697478 CCTGGCTCCCCTCTGTGATGTGG - Intergenic
928364669 2:30691813-30691835 CCAGGCCACACTGGGGGATGTGG + Intergenic
928498404 2:31859965-31859987 CCCAGCTACTCTGTGTGCTGAGG + Intergenic
934845710 2:97660241-97660263 TCCGGCTTCACTGTGAGAGGCGG + Intronic
936585915 2:113757414-113757436 CCCGGCTACACTGGAAGCTGAGG - Intergenic
937355634 2:121196494-121196516 CCGGGCTACACTGGGTGTGGGGG - Intergenic
940047120 2:149421474-149421496 CCCTACTACACTGAGTGTTGTGG + Intronic
940323384 2:152400315-152400337 CCCAGCTACTCTGTGGGCTGAGG + Intronic
940940034 2:159549525-159549547 CCGGGCTACACTGGATGAAGAGG + Intronic
942761128 2:179399515-179399537 CCCAGCTAGAGTGTGGGATGAGG + Intergenic
945857030 2:215081360-215081382 CCCAGCTACTCTGGGTGCTGAGG + Intronic
946719925 2:222593753-222593775 CCCGGCTACACTGATGGCTGAGG + Intronic
1173046680 20:39519247-39519269 CCCGTCTATATTGTGTGATTTGG - Intergenic
1177873048 21:26596710-26596732 CACTGCAACCCTGTGTGATGGGG + Intergenic
1181302766 22:21893208-21893230 CCCGGCTACACCGGGGGCTGAGG + Intergenic
1183742867 22:39678309-39678331 CCAGGCAACACTGGGGGATGAGG - Intronic
1184606273 22:45576489-45576511 CCCTGCTTCACTGTCTGATCTGG + Intronic
953129081 3:40120673-40120695 CCCTGCTAATCTGTGTGATCTGG - Intronic
954876353 3:53805508-53805530 CCCTGCTGCACTCTGTGATGGGG + Intronic
956434225 3:69217504-69217526 CCCAGCTACTCTGTGGGCTGAGG + Intronic
965434164 3:168626772-168626794 GCTGGGTCCACTGTGTGATGTGG - Intergenic
966930892 3:184674806-184674828 CCCGGCTACACTGTGTGATGGGG - Intronic
968680573 4:1916018-1916040 CCTGGCTGCACTGTGGGACGTGG + Intronic
970565995 4:17333278-17333300 CCCTACTACACTGTGTGGTTCGG - Intergenic
978168000 4:105631992-105632014 CCCGTTTACTCTGTGTGATAGGG + Intronic
981932364 4:150204774-150204796 CCCAGCTACTCTGTGGGCTGAGG + Intronic
985491498 5:182263-182285 CCAGGCTGCAGTGTGTGAGGGGG + Exonic
989284245 5:39680812-39680834 CACAGCTATTCTGTGTGATGTGG + Intergenic
990875140 5:60475855-60475877 CCCTGCAACGCTATGTGATGCGG - Intronic
998557876 5:143143315-143143337 CCTGCCTCCCCTGTGTGATGGGG + Intronic
1002270595 5:178069374-178069396 CCCAGCTACTCTGAGAGATGAGG + Intergenic
1008947690 6:57116847-57116869 CCCAGCTACTCTGTAGGATGAGG + Intronic
1009941410 6:70293129-70293151 CCCTGCTACACTCCGTGATATGG + Intronic
1015395048 6:132724233-132724255 CTTGGCTACACTGGGTTATGAGG + Intronic
1015791764 6:136970458-136970480 CCCAGCTACACTGGAGGATGAGG - Intergenic
1016888677 6:148983894-148983916 CATGTGTACACTGTGTGATGTGG - Intronic
1019173986 6:170150532-170150554 TCCGGCTTCACTGTGTACTGGGG - Intergenic
1019301886 7:309447-309469 CCCAGCCAAACTGTGGGATGCGG + Intergenic
1022054718 7:26718619-26718641 CCCGGCTACTCGGGGTGCTGAGG - Intronic
1030089152 7:105842010-105842032 CCCGGCTGGAATGTGAGATGGGG + Intronic
1031774922 7:125896254-125896276 CCCAGCTACTCTGGGTGCTGAGG - Intergenic
1032474439 7:132202636-132202658 CCCGGCTTACCTCTGTGATGCGG + Exonic
1038477445 8:27878080-27878102 CCCGGCTCCACTCCATGATGTGG + Intronic
1039200313 8:35083869-35083891 CAAGGGTATACTGTGTGATGCGG - Intergenic
1045324053 8:101103635-101103657 GCCGCCAACACTGTGTGCTGGGG - Intergenic
1045366839 8:101484587-101484609 CCCGGCTACTCGGTGGGCTGAGG - Intergenic
1049479977 8:142817986-142818008 CACGACCACACTGTGTGCTGAGG + Intergenic
1056393809 9:86163335-86163357 CCCGGCTACTCAGTGGGCTGAGG - Intergenic
1057524661 9:95787815-95787837 CCCAGCTACTCTGTCTGCTGAGG - Intergenic
1057776495 9:98014866-98014888 CCCAGCTACTCTGGATGATGAGG - Intronic
1061033826 9:128102549-128102571 CCCAGCTGCACTCTGGGATGGGG - Intronic
1186452626 X:9686122-9686144 CCCGGGCACACAGTGTGAAGGGG - Intronic
1189496237 X:41511481-41511503 CCCAGCTACATGGGGTGATGAGG + Intergenic
1189998430 X:46661614-46661636 CCCGGCCACATGGTGTTATGTGG - Intronic
1190937011 X:55006699-55006721 CCCGGCTTGACTATGTGCTGGGG + Exonic
1195637466 X:107133820-107133842 CCCGGCTACTCAGGGTGCTGGGG + Intronic
1198457178 X:136828284-136828306 CCCAGCTACATTGAGTGCTGTGG + Intergenic
1200908782 Y:8513395-8513417 CCGGCCAACACTGTGTGGTGAGG + Intergenic
1201620558 Y:15952513-15952535 CCCAGCTACTCAGTGTGCTGAGG - Intergenic