ID: 966937843

View in Genome Browser
Species Human (GRCh38)
Location 3:184725577-184725599
Sequence CAGGGGAAGCTGCATCAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966937843_966937850 -5 Left 966937843 3:184725577-184725599 CCGTCCTGATGCAGCTTCCCCTG No data
Right 966937850 3:184725595-184725617 CCCTGCCTCTAGGGGCTTCCTGG No data
966937843_966937857 28 Left 966937843 3:184725577-184725599 CCGTCCTGATGCAGCTTCCCCTG No data
Right 966937857 3:184725628-184725650 ACTTTGACTCCTGAGGAGAGTGG No data
966937843_966937852 -4 Left 966937843 3:184725577-184725599 CCGTCCTGATGCAGCTTCCCCTG No data
Right 966937852 3:184725596-184725618 CCTGCCTCTAGGGGCTTCCTGGG No data
966937843_966937856 21 Left 966937843 3:184725577-184725599 CCGTCCTGATGCAGCTTCCCCTG No data
Right 966937856 3:184725621-184725643 CATGCTGACTTTGACTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966937843 Original CRISPR CAGGGGAAGCTGCATCAGGA CGG (reversed) Intergenic
No off target data available for this crispr