ID: 966942790

View in Genome Browser
Species Human (GRCh38)
Location 3:184757572-184757594
Sequence CTGCATATGCACAATGTGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966942784_966942790 10 Left 966942784 3:184757539-184757561 CCTCTTACGAGACCGAGAGAACC 0: 1
1: 0
2: 0
3: 3
4: 20
Right 966942790 3:184757572-184757594 CTGCATATGCACAATGTGAGCGG 0: 1
1: 0
2: 0
3: 11
4: 136
966942783_966942790 18 Left 966942783 3:184757531-184757553 CCACTCTTCCTCTTACGAGACCG 0: 1
1: 0
2: 0
3: 6
4: 51
Right 966942790 3:184757572-184757594 CTGCATATGCACAATGTGAGCGG 0: 1
1: 0
2: 0
3: 11
4: 136
966942782_966942790 27 Left 966942782 3:184757522-184757544 CCAGGGTCACCACTCTTCCTCTT 0: 1
1: 0
2: 6
3: 23
4: 317
Right 966942790 3:184757572-184757594 CTGCATATGCACAATGTGAGCGG 0: 1
1: 0
2: 0
3: 11
4: 136
966942785_966942790 -2 Left 966942785 3:184757551-184757573 CCGAGAGAACCAGCTAGTCCCCT 0: 1
1: 0
2: 3
3: 22
4: 164
Right 966942790 3:184757572-184757594 CTGCATATGCACAATGTGAGCGG 0: 1
1: 0
2: 0
3: 11
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966942790 Original CRISPR CTGCATATGCACAATGTGAG CGG Intergenic
900869873 1:5294501-5294523 CTCCAGCTGCACAATGTGTGAGG + Intergenic
903938373 1:26912043-26912065 CTGCAGGTGCCCAATGTGGGAGG + Exonic
905913049 1:41666936-41666958 CTGCATGTGCAAAATGTGCTTGG - Intronic
907268852 1:53278689-53278711 CTGCACATGCACAAGTTGGGTGG - Intronic
908313296 1:62907242-62907264 CTCCATAAGCACAAGGAGAGGGG + Intergenic
912326422 1:108767622-108767644 CTGCACATGCGCAAGGTGGGCGG + Intronic
917742451 1:177974194-177974216 TTGCACATGCTGAATGTGAGGGG + Intronic
920387248 1:205577671-205577693 CTGCATTTGCACCTTCTGAGTGG + Intronic
920459196 1:206126026-206126048 CTGAAAATGTGCAATGTGAGTGG - Intergenic
922307698 1:224358222-224358244 CTAGATATGCACAATGAGAATGG + Intronic
924157887 1:241199941-241199963 CTTCATCTGCAAAATGTGGGTGG + Intronic
1065354169 10:24823098-24823120 TTGCATATACACAATGAGATGGG - Intergenic
1067336358 10:45368220-45368242 CTGCATGTGCACTATGTGTCTGG + Intergenic
1068173283 10:53422880-53422902 CTGAATGTCCAAAATGTGAGAGG - Intergenic
1077552562 11:3207535-3207557 CAGCATATGCACAGGGAGAGGGG - Intergenic
1083614641 11:64020329-64020351 CTCCAAATGTACATTGTGAGAGG - Intronic
1084725422 11:70938750-70938772 CAGCATATGCAAAATGCCAGAGG + Intronic
1086325993 11:85700036-85700058 TTGTATCTGCACAATGTGAATGG - Intronic
1086961586 11:92984081-92984103 CTGCATGTCCACAATGTGCCTGG + Intronic
1090831184 11:130421909-130421931 CTGCATGTGAAGAATGTGAACGG + Intronic
1090975478 11:131676521-131676543 CTGCATATGCACATAGTGGAGGG + Intronic
1094670750 12:32566483-32566505 CTGGTTATGTACTATGTGAGCGG - Intronic
1096042040 12:48526049-48526071 CTGTATATGCACCTTGTGTGGGG + Exonic
1096233545 12:49910729-49910751 CTGGAGAGGCACAGTGTGAGGGG - Intergenic
1098856544 12:75659085-75659107 CTGAATGTGCAAAATATGAGTGG - Intergenic
1099733688 12:86538959-86538981 CTGCATATGCATAATTTAATAGG + Intronic
1100448042 12:94679076-94679098 CTGCAAAAGCACAAAGGGAGAGG - Intergenic
1104121682 12:125805937-125805959 CTGCATTGGCAGAAGGTGAGGGG + Intergenic
1106112565 13:26789729-26789751 CTGCATGTGCACAGTGAGATAGG + Intergenic
1107327342 13:39258799-39258821 TTCCATTTGCACAATGTGGGTGG - Intergenic
1107759131 13:43657572-43657594 CTGCTTCTGCACAAAGTGAAGGG - Intronic
1111859171 13:93679997-93680019 CTCCATATCCACAAACTGAGAGG - Intronic
1112962732 13:105147509-105147531 CTGCCAGTGCACAATGTGAGTGG - Intergenic
1114639704 14:24211316-24211338 CTGCAAATTCACATTCTGAGAGG + Intronic
1117037186 14:51741520-51741542 CTTAATATCCACAATGGGAGAGG - Intergenic
1118696071 14:68386518-68386540 CTGCATGTGCTAAATGTGGGAGG - Intronic
1121024694 14:90606828-90606850 CTGCATATGGACAATTTCAGAGG + Intronic
1121053859 14:90837050-90837072 TAGCATTTGCACAGTGTGAGGGG + Intergenic
1128819694 15:70640633-70640655 CTGCAGCAGCACAATGGGAGTGG - Intergenic
1129319893 15:74768641-74768663 GTACATGTGCACAATGTGCGGGG + Intergenic
1133194529 16:4159524-4159546 CTGCATAGGGACAAGGTCAGTGG - Intergenic
1135914612 16:26594585-26594607 TTGCAGATGCACAATATCAGGGG - Intergenic
1147239426 17:39080793-39080815 CTGCAGATGCACACAGTCAGAGG + Intronic
1155218443 18:23663076-23663098 GAGCGTATGCACAATGTGTGTGG - Intergenic
1156204040 18:34866554-34866576 CTGAATACTCACAGTGTGAGTGG - Intronic
1158630609 18:59111026-59111048 CTGCAAATGCAAAGTGTGTGTGG + Intergenic
925437987 2:3857752-3857774 CTGCAGAGGCACAACATGAGTGG + Intergenic
926983571 2:18597094-18597116 CTGCATATGCACCATGAGCAGGG - Intergenic
931871341 2:66463734-66463756 CTGGAAATGCAAAATGAGAGTGG - Intronic
931910535 2:66894787-66894809 CTGCATCTGCATAAAGTGAAGGG + Intergenic
931928091 2:67097080-67097102 CTGCATATGCAAAGGGTCAGAGG + Intergenic
933413914 2:81960105-81960127 CTACATAAAGACAATGTGAGTGG - Intergenic
935425217 2:102912250-102912272 CTGCACAGGCCAAATGTGAGAGG + Intergenic
936608637 2:113980259-113980281 CTGCATAACCACACAGTGAGAGG + Intergenic
937254429 2:120545132-120545154 CTGCAGATGCACGAAATGAGTGG + Intergenic
939999006 2:148948502-148948524 CTGCCTCTGCACAGTGTCAGTGG + Intronic
940692821 2:156940822-156940844 CTACATATGTATAGTGTGAGAGG + Intergenic
945832640 2:214805583-214805605 CTTCATCTGCACAAAATGAGTGG - Intronic
948565771 2:238885104-238885126 CTGCATCTGCACAATCTGGGAGG - Intronic
1170740508 20:19051784-19051806 CAAAATGTGCACAATGTGAGGGG - Intergenic
1170828894 20:19822260-19822282 CTACATCTGAACAATGAGAGTGG + Intergenic
1171092015 20:22294237-22294259 CTTCAGATGCAAAAGGTGAGAGG - Intergenic
1172182939 20:33014633-33014655 CTGCACCTTCCCAATGTGAGCGG + Intronic
1172780344 20:37433068-37433090 GTTCATCTGCCCAATGTGAGAGG + Intergenic
1174437857 20:50524014-50524036 ATGCATATGCATTGTGTGAGGGG - Intronic
1176687350 21:9862571-9862593 GTGCATATGCAAGCTGTGAGTGG - Intergenic
1177186751 21:17805918-17805940 CTCCATATGCCCCATGTAAGTGG - Intronic
1178330583 21:31687104-31687126 CTTCATTTTCTCAATGTGAGGGG - Intronic
1178932267 21:36829903-36829925 CTGCACATGCACAGGGTTAGAGG + Intronic
1180219388 21:46348335-46348357 CTGCATCTGCACAAAGCGAGAGG - Intronic
1181477807 22:23179725-23179747 CAGCAGATCCACAACGTGAGAGG + Intronic
950463224 3:13138085-13138107 CTCCATATGCAAAATGAGAGGGG + Intergenic
950581621 3:13866041-13866063 CTGCATATGCAGGATATGACAGG + Intronic
956028115 3:65005720-65005742 CTGCAGAGGCACAATTTGAATGG - Intergenic
960427874 3:117531315-117531337 CTGCTGATGCACTGTGTGAGTGG - Intergenic
961010060 3:123429734-123429756 CTGCATATGCACCATCAGGGTGG + Intronic
961213303 3:125141794-125141816 CTGCGAATGGACAATGGGAGAGG + Intronic
962241485 3:133754472-133754494 CTGCAAAGGCACAGTGTGAATGG - Intronic
962975600 3:140443124-140443146 CTGGATTTACACAAAGTGAGTGG - Intronic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
964783498 3:160367432-160367454 CTGCTTAAGCAGCATGTGAGGGG - Intronic
966942790 3:184757572-184757594 CTGCATATGCACAATGTGAGCGG + Intergenic
969930202 4:10623467-10623489 CTGCATATCTACAAGGTTAGTGG - Intronic
971580363 4:28331074-28331096 CTGCATATGAAAAAAGAGAGAGG - Intergenic
973222683 4:47746846-47746868 CTTGATATGCACTTTGTGAGTGG + Intronic
983515937 4:168656694-168656716 CTGCATATCCAGATTGTGGGGGG + Intronic
983806864 4:172004582-172004604 CAGCATATGTACAATATAAGTGG + Intronic
984815966 4:183836515-183836537 ATGAATGTGAACAATGTGAGGGG + Intergenic
985910193 5:2873395-2873417 CTGAATATGCATAATGGGAGTGG - Intergenic
986295097 5:6431115-6431137 CTCCATCTGCACAATCTCAGAGG + Intergenic
986629124 5:9752492-9752514 ATGCATAAAAACAATGTGAGGGG - Intergenic
995949707 5:117695799-117695821 TTACATATGCCCAATGTTAGTGG + Intergenic
998127333 5:139633523-139633545 CTGCATGGGCACAACCTGAGAGG + Intergenic
998347816 5:141479729-141479751 AAGTATATGCACAATGTGAAAGG + Intronic
1001217995 5:169873962-169873984 CTGAATATGAAAACTGTGAGGGG + Intronic
1001588331 5:172848667-172848689 CAGCATCTGCACACTGTGGGTGG + Intronic
1002571078 5:180139736-180139758 CTGCACATGCTCAGTGGGAGGGG + Intronic
1004313974 6:14570426-14570448 CTTCAAAAGCACACTGTGAGAGG - Intergenic
1006925584 6:37652574-37652596 CAGAATATACACTATGTGAGAGG + Intronic
1009939498 6:70273569-70273591 CTGCATTTGCACAATATGGCAGG - Intronic
1010496477 6:76538714-76538736 CTGCATGTGATCAATGTTAGTGG - Intergenic
1012652715 6:101777012-101777034 CTGCCTATGCACCATGTGCCAGG + Intronic
1016345422 6:143108177-143108199 CTGCATAAGCACATTGTAACGGG + Intronic
1016787426 6:148027218-148027240 CTGCCTATGAATAATGTAAGTGG + Intergenic
1017210964 6:151855645-151855667 CTGCTTATACACAAGGTGAAAGG + Intronic
1018793415 6:167168141-167168163 CTGCAAATGAGCAATGTGATGGG - Intronic
1018823298 6:167390237-167390259 CTGCAAATGAGCAATGTGACGGG + Intergenic
1019209801 6:170395626-170395648 CAGCAAAAGCACAAGGTGAGAGG - Intronic
1021124643 7:16837082-16837104 CTGCAGATGAAAAATGAGAGTGG + Intergenic
1021840157 7:24715887-24715909 CTTCATTTGCAGAATGAGAGAGG + Intronic
1024677948 7:51654849-51654871 CTGCCTATGGCCAATGTGGGGGG - Intergenic
1025272481 7:57538052-57538074 GTACATATGCACAATGTGCAAGG + Intergenic
1025525794 7:61808420-61808442 CTGCTTATGGAGAATCTGAGAGG - Intergenic
1025549185 7:62221153-62221175 CTGCTTATGGAGAATCTGAGAGG - Intergenic
1028370454 7:90086580-90086602 CTGCAAAAGCACATTGTGAGGGG - Intergenic
1030815991 7:114038336-114038358 CTTCATTTGCAAAATGTTAGTGG + Intronic
1031036964 7:116798423-116798445 CTGCATTTGCATAATGATAGAGG + Intergenic
1033492988 7:141862655-141862677 CTAAATATGTACAATGTGTGAGG - Intergenic
1035670539 8:1413855-1413877 GTGCAGATGCACAATGTCAATGG + Intergenic
1036294203 8:7522112-7522134 GTGCATTTCCACATTGTGAGGGG + Intergenic
1036295978 8:7537527-7537549 CTGCATTTCCACATTGTGAGGGG + Intergenic
1036326588 8:7783492-7783514 CTGCATTTCCACATTGTGAGGGG - Intergenic
1036328359 8:7798879-7798901 GTGCATTTCCACATTGTGAGGGG - Intergenic
1037124748 8:15334143-15334165 CTGCATGTGCAGAATGTGTTTGG - Intergenic
1037925305 8:22839472-22839494 CTCCACATGCAAAATGGGAGAGG + Intronic
1038162326 8:25051774-25051796 CTGCATCTGCTCACTTTGAGAGG - Intergenic
1039657655 8:39427623-39427645 CTGCTTTTGCATAATCTGAGTGG + Intergenic
1040820719 8:51553443-51553465 CTGCAGATGCACAGAATGAGTGG - Intronic
1042805446 8:72766049-72766071 ATGCTTGTGCACAATGAGAGGGG + Intronic
1042846340 8:73172862-73172884 CAGGACATGCACAATGTGAGTGG - Intergenic
1042846344 8:73172887-73172909 CAGGACATACACAATGTGAGTGG - Intergenic
1043547789 8:81334805-81334827 TTGCTCATGCAGAATGTGAGAGG - Intergenic
1043686094 8:83087837-83087859 TTGCATCTGGACAATGTGTGAGG - Intergenic
1047445241 8:124913579-124913601 CTGCATAAACACAGTGTGTGAGG + Intergenic
1049818878 8:144622179-144622201 CTGCACAGGCCCAAGGTGAGGGG + Intergenic
1051016428 9:12481136-12481158 CTGGATATGCCCAATGTTATTGG - Intergenic
1052388085 9:27845748-27845770 GTGCACATGCACAGTGTCAGGGG + Intergenic
1053781951 9:41619030-41619052 GTGCATATGCAAGCTGTGAGTGG + Intergenic
1054169902 9:61829184-61829206 GTGCATATGCAAGCTGTGAGTGG + Intergenic
1054667636 9:67751631-67751653 GTGCATATGCAAGCTGTGAGTGG - Intergenic
1058038425 9:100278345-100278367 CTGCATATGAAGAATGAGAGAGG - Intronic
1060961851 9:127686370-127686392 CTGAATATACAGAATGTCAGAGG - Intronic
1062378293 9:136274833-136274855 CTGCATTTCCACATTGGGAGGGG + Intergenic
1192542958 X:71990557-71990579 CTGCAAATCAACAGTGTGAGCGG - Intergenic
1193385427 X:80865450-80865472 CTTCATCTGTAAAATGTGAGGGG - Intergenic
1194588141 X:95763008-95763030 CTGCACATGCACAAAGAAAGGGG + Intergenic
1196610582 X:117710013-117710035 CTGTATAAGCACCATGAGAGAGG - Intergenic
1197376410 X:125687262-125687284 CTACATGTGCCCAAAGTGAGGGG + Intergenic