ID: 966942967

View in Genome Browser
Species Human (GRCh38)
Location 3:184758506-184758528
Sequence TCATCTACTGGGACACTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 116}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966942967_966942975 19 Left 966942967 3:184758506-184758528 CCTGCCAGTGTCCCAGTAGATGA 0: 1
1: 0
2: 1
3: 9
4: 116
Right 966942975 3:184758548-184758570 CCCAGTGAAGGTGTGTCCCATGG 0: 1
1: 0
2: 1
3: 22
4: 180
966942967_966942979 27 Left 966942967 3:184758506-184758528 CCTGCCAGTGTCCCAGTAGATGA 0: 1
1: 0
2: 1
3: 9
4: 116
Right 966942979 3:184758556-184758578 AGGTGTGTCCCATGGGCCACGGG 0: 1
1: 0
2: 4
3: 21
4: 224
966942967_966942978 26 Left 966942967 3:184758506-184758528 CCTGCCAGTGTCCCAGTAGATGA 0: 1
1: 0
2: 1
3: 9
4: 116
Right 966942978 3:184758555-184758577 AAGGTGTGTCCCATGGGCCACGG 0: 1
1: 0
2: 2
3: 15
4: 225
966942967_966942971 -4 Left 966942967 3:184758506-184758528 CCTGCCAGTGTCCCAGTAGATGA 0: 1
1: 0
2: 1
3: 9
4: 116
Right 966942971 3:184758525-184758547 ATGAAGCCGACAGACAGCTCAGG 0: 1
1: 0
2: 0
3: 13
4: 127
966942967_966942973 7 Left 966942967 3:184758506-184758528 CCTGCCAGTGTCCCAGTAGATGA 0: 1
1: 0
2: 1
3: 9
4: 116
Right 966942973 3:184758536-184758558 AGACAGCTCAGGCCCAGTGAAGG 0: 1
1: 0
2: 4
3: 38
4: 387
966942967_966942977 20 Left 966942967 3:184758506-184758528 CCTGCCAGTGTCCCAGTAGATGA 0: 1
1: 0
2: 1
3: 9
4: 116
Right 966942977 3:184758549-184758571 CCAGTGAAGGTGTGTCCCATGGG 0: 1
1: 0
2: 1
3: 18
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966942967 Original CRISPR TCATCTACTGGGACACTGGC AGG (reversed) Intergenic
902535109 1:17115228-17115250 TCTTCTACTGGGACAATGGCTGG + Intronic
907131719 1:52103185-52103207 TCATCTCCTGGGGCACTTGTAGG + Intergenic
909980660 1:82096377-82096399 ACATATCCTGGGGCACTGGCTGG + Intergenic
916527032 1:165620068-165620090 TCAGCTCCTGGGACACTGCTTGG - Intergenic
916602673 1:166308106-166308128 TCATCTTTTGGGACTGTGGCTGG + Intergenic
918070640 1:181131396-181131418 GCATCTACAGGGACACTGGGTGG + Intergenic
922621961 1:226995386-226995408 TCATCTATTGGGAGAATGACAGG - Intronic
924289709 1:242524689-242524711 GCACCTACTGGGACCCGGGCCGG + Intronic
1063540505 10:6928871-6928893 TCATTTACTGGGCCAGTGTCAGG + Intergenic
1068740248 10:60460989-60461011 ACTTCTAGTGGAACACTGGCTGG + Intronic
1069762731 10:70825195-70825217 TTTCCTACTGGGTCACTGGCTGG - Intronic
1071024883 10:81100440-81100462 TCAGCTACTGGGACAGTGTTTGG + Intergenic
1071506297 10:86233812-86233834 TCCACTACTGGGACTCTGGAAGG + Intronic
1074103656 10:110373514-110373536 ACAGCTGCTGGGACAGTGGCAGG + Intergenic
1075765150 10:124887195-124887217 TCACGCACTGGGACACTGGCTGG - Intergenic
1075859336 10:125661445-125661467 TCATCTCCTGGGACCCTTACTGG - Intronic
1078903603 11:15664105-15664127 TCATCTTCTGGAGCACTGACAGG + Intergenic
1079343423 11:19631741-19631763 CCATCTCCTGGGACACTAGTGGG - Intronic
1080213744 11:29817587-29817609 TGACATACTGAGACACTGGCTGG - Intergenic
1080575752 11:33597688-33597710 TCATCTTCTGGAACTCTGTCAGG - Intronic
1083478147 11:62926924-62926946 TCCTCTCCTGAGACACTTGCAGG + Intergenic
1087733162 11:101801184-101801206 TTATTTACTGGCACACAGGCTGG + Intronic
1089439648 11:118504726-118504748 TAGTCTACTGGGATTCTGGCTGG - Exonic
1094711971 12:32973526-32973548 TGATCTCCTGGGACATTGTCTGG + Intergenic
1095573694 12:43710475-43710497 TGACCTACTGAGACACTGGCAGG - Intergenic
1097170145 12:57108176-57108198 GCATCTTCTGGGTGACTGGCTGG - Exonic
1098630627 12:72717351-72717373 TGATCATCTGTGACACTGGCTGG - Intergenic
1101403293 12:104406837-104406859 TCAGCAATTGGGACACTGCCTGG - Intergenic
1104018373 12:124975432-124975454 TCATCTCCTTGGCCACTCGCTGG + Exonic
1107504176 13:41014806-41014828 TCATCTAATGGGACATTGTTAGG - Intronic
1117766727 14:59091274-59091296 TCATCTACTGTGTAACTGACTGG + Intergenic
1119788270 14:77328385-77328407 TCATATACTGGGATACTTGTAGG + Intronic
1121097151 14:91225466-91225488 TCACCTGCTGGGTGACTGGCAGG - Intronic
1121397029 14:93634620-93634642 TCAGCAACTGGGACACTGGTGGG + Exonic
1121497348 14:94403002-94403024 CCATCAACTGGAACACTGTCAGG - Intergenic
1122035181 14:98943827-98943849 TCATGAACTTGGACACAGGCTGG + Intergenic
1132976578 16:2714084-2714106 TGAACTGCTGGGTCACTGGCTGG - Exonic
1133361228 16:5175377-5175399 TCACCTACTGGGGCACCAGCTGG + Intergenic
1133650262 16:7806191-7806213 ACATCAACTGGGAGACTGACTGG + Intergenic
1134318105 16:13138478-13138500 TCATCTCCTATGACACTGCCTGG + Intronic
1134648250 16:15888243-15888265 TCATCTTCTTGGACCCTGCCGGG - Intronic
1141879226 16:86846798-86846820 CCATCCACTGGTCCACTGGCAGG - Intergenic
1146485655 17:33240524-33240546 TCATCTCCAGGGACCCTGCCAGG + Intronic
1148165048 17:45477699-45477721 AGATCTGCTGGCACACTGGCTGG + Intronic
1149908168 17:60545956-60545978 TCCTCTCCAGGGAAACTGGCTGG - Intergenic
1150396278 17:64824424-64824446 AGATCTGCTGGCACACTGGCTGG + Intergenic
1155308169 18:24499047-24499069 TCAGTTACTGGGACACGGGCAGG - Intergenic
1157816291 18:50731394-50731416 TCCTCTACCTGGAAACTGGCTGG - Exonic
1162495498 19:11021158-11021180 ACATCAACTGAGCCACTGGCAGG - Intronic
929388724 2:41442863-41442885 TAATATACTGAGACACTAGCTGG - Intergenic
930859275 2:56053034-56053056 TCTTCTACTGAAACACTGCCGGG + Intergenic
932586577 2:73033890-73033912 GCATCTACTGGGTCACAGCCAGG + Intronic
934066104 2:88343551-88343573 TCATTTACTGGGAGCCTGTCTGG - Intergenic
935688440 2:105708477-105708499 TCTTCATCTGGGACACAGGCAGG + Intergenic
936273643 2:111071668-111071690 TCATCTTCTCTGACACTGGAGGG + Intronic
939006243 2:136790978-136791000 CCAGCTACTGGGGCACTGGAAGG + Intronic
941531173 2:166673307-166673329 TCATATATTGGAACATTGGCTGG + Intergenic
942370959 2:175284088-175284110 GCATCTACTGGGTCACTTGCTGG - Intergenic
944445365 2:199783531-199783553 CCATCTTCTGGGACCCTGTCAGG + Intronic
945214852 2:207422462-207422484 GCATCTACTGGGACCATGGTTGG - Intergenic
946151758 2:217778303-217778325 TCTTCTGCTGGGACAATGTCAGG + Intergenic
946167227 2:217871744-217871766 TCATCTCCTGGGGCCCAGGCCGG - Intronic
947349732 2:229231072-229231094 GCTTCAGCTGGGACACTGGCTGG - Intronic
948065253 2:235073978-235074000 ACATTTACTGGGTGACTGGCTGG + Intergenic
1171197047 20:23207927-23207949 TCTTCCACTGGGTCACTGCCTGG - Intergenic
1171879568 20:30608213-30608235 TCACCTACTGTGACACTTGGAGG + Intergenic
1172021844 20:31920155-31920177 CCATTTACTGGGGCACTGACAGG - Intronic
1173385304 20:42582124-42582146 CCATCTACTGGGACCCAGGAGGG - Intronic
1173523825 20:43717339-43717361 TCAAGAACTGGGACACTGCCAGG - Intergenic
1173828129 20:46060321-46060343 TCATCTCCTAAGAGACTGGCAGG + Intergenic
1175704332 20:61164992-61165014 TCATCTCCTGAGCCCCTGGCAGG + Intergenic
1175905637 20:62378101-62378123 TCATCTGCTGGGACTCCTGCAGG - Intergenic
1177432545 21:21009045-21009067 GCATTTAATGGGACACTAGCAGG - Intronic
1180728665 22:17964832-17964854 TGCTCAGCTGGGACACTGGCTGG + Intronic
1181622061 22:24098048-24098070 TCTTCAGCTGGGACACTGCCGGG + Exonic
1182468158 22:30530972-30530994 ACATCCACAGGGACATTGGCAGG + Intronic
951218202 3:20043463-20043485 TCATAGACTGGGGCACTGGTAGG + Intronic
957377335 3:79375520-79375542 TTATCTTCAGGGCCACTGGCTGG - Intronic
959595799 3:108127299-108127321 CCATTCACTGGGAGACTGGCTGG - Intergenic
960665272 3:120102946-120102968 TGACCAACTGGAACACTGGCTGG - Intergenic
964570243 3:158102872-158102894 TCAGCTCCGGGGACACTGGAGGG + Exonic
964625270 3:158752707-158752729 TTTTCTCCTGGGACACTGACAGG - Intronic
965047392 3:163597241-163597263 TGATCTACTGCGACACCAGCTGG + Intergenic
966942967 3:184758506-184758528 TCATCTACTGGGACACTGGCAGG - Intergenic
973760502 4:54110273-54110295 TTATCAACTGCGTCACTGGCAGG + Intronic
977868324 4:102058164-102058186 TTATTTACTAGGAGACTGGCTGG - Intronic
978030832 4:103938671-103938693 TCATATACTGAGACACCAGCTGG + Intergenic
982969877 4:161971882-161971904 TCATCAACTGGGAAACAGACTGG - Intronic
986444829 5:7812116-7812138 TTAACTACTATGACACTGGCAGG - Intronic
986781733 5:11072778-11072800 CCAGACACTGGGACACTGGCGGG + Intronic
987661774 5:20887679-20887701 TCATCACCTGGGACCCTGGTGGG - Intergenic
988299335 5:29403128-29403150 TAATCTACTGGGAAACCAGCTGG + Intergenic
988384124 5:30539445-30539467 TGAACTACTGAGATACTGGCTGG + Intergenic
988761807 5:34317631-34317653 TCATCACCTGGGACCCTGGTGGG + Intergenic
997845566 5:137283029-137283051 GCATCTACAGGGGCACAGGCTGG + Intronic
1002578886 5:180195196-180195218 TCAGCTCCAGGGACGCTGGCGGG - Intronic
1002793567 6:452568-452590 TCATCTCCTGGGATGCTGGCTGG - Intergenic
1005475622 6:26204793-26204815 TCATCTACGAGGAGACTCGCGGG + Exonic
1005643999 6:27824273-27824295 TCATCTACGAGGAGACTCGCGGG + Exonic
1005645198 6:27831357-27831379 TCATCTACGAGGAGACTCGCGGG - Exonic
1006137836 6:31906719-31906741 TCATTTGCAGGGACACAGGCAGG - Intronic
1008770590 6:54974077-54974099 GCATCTACAGGCACACTTGCAGG - Intergenic
1012245977 6:96925981-96926003 TCCTCTACTGGAACACTGATAGG + Intronic
1013352478 6:109318013-109318035 TCATGCACTGAGACACAGGCAGG + Intergenic
1013613397 6:111817883-111817905 TCCTCCACTGGGGCACTGTCTGG + Intronic
1016191409 6:141271141-141271163 TCATCTACCGGGACTCTTGACGG + Intergenic
1016905900 6:149150663-149150685 TCATCTTCTGGGATCCTTGCAGG - Intergenic
1018606091 6:165599735-165599757 TCAACTGCTGGGTCACAGGCAGG + Intronic
1020529051 7:9306610-9306632 TCATCTACTTGCTGACTGGCCGG + Intergenic
1021623014 7:22566126-22566148 TCATCTATTGGGACATCTGCTGG + Intronic
1022391849 7:29950390-29950412 TCATCTTGGGGGGCACTGGCAGG - Intronic
1027635064 7:80661632-80661654 ACAGCTACTGGTACACTGTCTGG - Intronic
1029211891 7:98916054-98916076 TCATCTACTGGGACTTTGAAGGG + Intronic
1031771886 7:125854053-125854075 TCATCTCCTGAGAGACTGGCAGG + Intergenic
1044193137 8:89343032-89343054 TGATCTACTGGGACACCAGTTGG - Intergenic
1048329793 8:133463798-133463820 CCAGCTGCTGGGGCACTGGCTGG + Intronic
1059366206 9:113788321-113788343 TCCTCTCCTGGGACACTCCCCGG - Intergenic
1061420919 9:130472463-130472485 TCAGTTCCTAGGACACTGGCTGG + Intronic
1062249662 9:135587817-135587839 TCCTCCACTGGGACAATGGGAGG - Intergenic
1188943127 X:36264259-36264281 TGATCTACTGAGACACCAGCTGG - Intronic
1190405245 X:50080421-50080443 TCAACTACTGAAACACTGTCAGG - Intronic
1193596489 X:83451945-83451967 CCATCTACTGAGACACCAGCTGG - Intergenic
1194520599 X:94914431-94914453 TGACCTACTGAGACACTGGCTGG + Intergenic
1197391976 X:125878377-125878399 CAATCTACTGGGACACCAGCTGG - Intergenic
1199032172 X:143013517-143013539 TGACCTACTGAGACACTAGCTGG + Intergenic
1201788373 Y:17809477-17809499 TCCTCACCTGGGACACAGGCAGG + Intergenic
1201813180 Y:18096511-18096533 TCCTCACCTGGGACACAGGCAGG - Intergenic