ID: 966943512

View in Genome Browser
Species Human (GRCh38)
Location 3:184761609-184761631
Sequence GGGGTGTGCCAGAACTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966943504_966943512 0 Left 966943504 3:184761586-184761608 CCCACATGTCCCCTGGCAAATAT No data
Right 966943512 3:184761609-184761631 GGGGTGTGCCAGAACTCTCCTGG No data
966943509_966943512 -9 Left 966943509 3:184761595-184761617 CCCCTGGCAAATATGGGGTGTGC No data
Right 966943512 3:184761609-184761631 GGGGTGTGCCAGAACTCTCCTGG No data
966943510_966943512 -10 Left 966943510 3:184761596-184761618 CCCTGGCAAATATGGGGTGTGCC No data
Right 966943512 3:184761609-184761631 GGGGTGTGCCAGAACTCTCCTGG No data
966943505_966943512 -1 Left 966943505 3:184761587-184761609 CCACATGTCCCCTGGCAAATATG No data
Right 966943512 3:184761609-184761631 GGGGTGTGCCAGAACTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966943512 Original CRISPR GGGGTGTGCCAGAACTCTCC TGG Intergenic
No off target data available for this crispr