ID: 966945201

View in Genome Browser
Species Human (GRCh38)
Location 3:184772979-184773001
Sequence TGGCGCCAGCTCGGGGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966945201_966945210 10 Left 966945201 3:184772979-184773001 CCTGATTCCCCGAGCTGGCGCCA 0: 1
1: 0
2: 0
3: 3
4: 94
Right 966945210 3:184773012-184773034 GCACTGTGTTAGCTCTGAGAGGG 0: 1
1: 0
2: 1
3: 14
4: 149
966945201_966945211 11 Left 966945201 3:184772979-184773001 CCTGATTCCCCGAGCTGGCGCCA 0: 1
1: 0
2: 0
3: 3
4: 94
Right 966945211 3:184773013-184773035 CACTGTGTTAGCTCTGAGAGGGG 0: 1
1: 0
2: 0
3: 12
4: 218
966945201_966945209 9 Left 966945201 3:184772979-184773001 CCTGATTCCCCGAGCTGGCGCCA 0: 1
1: 0
2: 0
3: 3
4: 94
Right 966945209 3:184773011-184773033 TGCACTGTGTTAGCTCTGAGAGG 0: 1
1: 0
2: 1
3: 10
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966945201 Original CRISPR TGGCGCCAGCTCGGGGAATC AGG (reversed) Intergenic
901014201 1:6218460-6218482 TGGCGCCAGCTCTGGGGCCCTGG + Intronic
903117239 1:21188375-21188397 TGACGCCAGCTGTGGGCATCTGG - Intergenic
905742853 1:40387853-40387875 GGGAGCCAGCTCCGGGAACCGGG + Intronic
906636338 1:47412842-47412864 CGGCTCCAGCTCCGGGAAGCAGG + Intergenic
916786819 1:168092566-168092588 AGGCACAGGCTCGGGGAATCAGG + Intronic
920118175 1:203636033-203636055 TGGGGCCAGCTGAGGGAACCTGG + Intronic
920409639 1:205749574-205749596 TGGAGCCAGCGCGGGGAGGCGGG - Intronic
923008537 1:230070609-230070631 TCGTGCCAGCTCAGGGAATAAGG - Intronic
1067451631 10:46385296-46385318 TGGCCACAGCTCTGGGACTCTGG + Intronic
1067585608 10:47474460-47474482 TGGCCACAGCTCTGGGACTCTGG - Intronic
1073143346 10:101263067-101263089 TTGGGACAGCTCGGGGAAACAGG - Intergenic
1074906166 10:117865697-117865719 TTGCGCCAACTCTGGGAAGCTGG - Intergenic
1085430768 11:76445628-76445650 CGGAGCCCGCTCGGGGAACCAGG - Intronic
1088589961 11:111394987-111395009 TCCCTCCAGCTCAGGGAATCTGG + Intronic
1089579929 11:119475258-119475280 TGACCCCAGCTCGGGGACACAGG - Intergenic
1090920664 11:131203592-131203614 AGGGCCCAGCCCGGGGAATCAGG - Intergenic
1091404514 12:200855-200877 TGGGGTCAGCTCTGAGAATCAGG - Intronic
1096244908 12:49979140-49979162 TAGCTCCAGCTGGGGGAAGCAGG + Intronic
1097147595 12:56952386-56952408 GGGCTCCAGCTCAGGGAATTTGG - Intronic
1097688835 12:62715268-62715290 GGGCCCCAGCTTGGGGATTCTGG + Intronic
1098487543 12:71039379-71039401 TGGGGACAGCTAGGGGACTCAGG - Intergenic
1103886913 12:124209184-124209206 TGGAGCCAGCTCATGAAATCGGG + Intronic
1103941573 12:124504081-124504103 TGGTGCCAGGTGGGGGACTCGGG - Intronic
1104774859 12:131385055-131385077 TGGAGCCAGGTAGGGGAATGGGG - Intergenic
1105274212 13:18905462-18905484 AGCCGCCAGCTCGGGGTATGTGG - Intergenic
1122989165 14:105228737-105228759 TGGCGCCTGCTCTGGCAAGCAGG + Intronic
1126777548 15:52112604-52112626 TGGCGCCGGCTCGGGGGTGCCGG + Exonic
1127055684 15:55128874-55128896 TGGTGGCAGCTCCTGGAATCAGG + Intergenic
1129823444 15:78619772-78619794 TGGGGGCAGCTTGGGGAAGCGGG + Intronic
1132405674 15:101540815-101540837 TGGAGCCAGCCCCGGGGATCTGG + Intergenic
1132642080 16:982531-982553 CGGCGCCAGCTATGGGAGTCGGG + Intronic
1133465194 16:6020828-6020850 TGGCGCCAGCTGCGGGGACCAGG + Intronic
1133768587 16:8854758-8854780 GGGGGCCAGATCTGGGAATCTGG + Exonic
1137457709 16:48630864-48630886 TGGGGCCAGCTTGGGCAGTCGGG + Intergenic
1138386554 16:56639337-56639359 TGGGGCCATCTCCAGGAATCTGG + Intronic
1141315732 16:82961100-82961122 TGGCGCCAGCTCAGGGGGTGTGG - Intronic
1141677950 16:85527454-85527476 TGGCCCCAGCTCTGGGCATGTGG - Intergenic
1142067043 16:88068631-88068653 GGGCGCCAGCTCGGGGTCTGTGG + Intronic
1142185380 16:88692368-88692390 TGGCGCCAGCCCCAGGAAACGGG - Intergenic
1143976703 17:10835665-10835687 TGGCCCCAGCTCGGGGACCCCGG - Intronic
1145295864 17:21592516-21592538 TGGAGCCAGCTCCGGGACGCCGG - Intergenic
1145943779 17:28758551-28758573 TAGCGACAGCTCGGGGTCTCAGG - Exonic
1146438909 17:32876872-32876894 TGGCGCCAGCGCGGGGGCTCAGG + Exonic
1150101366 17:62426389-62426411 AGGTGCCAGCTCAGGGAATTCGG - Exonic
1151938922 17:77281086-77281108 TGGCGCCAGCGCGGGGAGCTGGG + Intronic
1152587938 17:81197434-81197456 TGGAGGCAGCTCGGGGCAGCGGG + Intronic
1153303964 18:3615728-3615750 TGGAGCCAGTTGGGGGAAACAGG - Intronic
1155416632 18:25605828-25605850 AAGCCCCAGCTCTGGGAATCTGG - Intergenic
1160008577 18:75087405-75087427 GGGCGCCAGCTCGGAGGCTCTGG - Intergenic
1160882427 19:1327296-1327318 CGGCTCCAGCTCGGGGAAGGGGG - Intergenic
1160900122 19:1423799-1423821 GGGCGCCAGCTCTGGGCAGCCGG - Intronic
1161479076 19:4501720-4501742 TGGCGCCAGCGTGGGGACCCTGG + Intronic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1164386687 19:27777353-27777375 TGGCGCCAGCTAGAGCCATCTGG - Intergenic
1166930643 19:46299206-46299228 TGGGGCCAGCTGGGGCGATCTGG + Intronic
1168246620 19:55115844-55115866 TGGTCCCAGCTCGGGGACACAGG + Intronic
935624807 2:105163409-105163431 TTGAGCCATCCCGGGGAATCAGG - Intergenic
948033316 2:234837383-234837405 TGTCACCAGCTCGGGGAAATAGG - Intergenic
948121974 2:235537380-235537402 TGGCGTCAGCTCAGGGAAGCAGG + Intronic
948485835 2:238280174-238280196 TGGGGCCAGCTGTTGGAATCCGG - Intronic
1172474573 20:35227007-35227029 GGGCGCGGGCTCGGGGCATCCGG + Intronic
1172815344 20:37681785-37681807 TGGCGCAAGCTCAGCGACTCTGG + Intergenic
1173669755 20:44790472-44790494 GGTCCCCAGCTCTGGGAATCAGG - Intronic
1179299915 21:40098482-40098504 TGGCTCCAGCTCAGGGCCTCTGG + Intronic
1179826822 21:43970814-43970836 TGGCCCCGGCTCGGGCAGTCTGG - Intronic
1180230795 21:46425744-46425766 TGGCGGCAGCTCGGGGCCGCAGG + Intronic
1180699345 22:17773285-17773307 AGACCCCAGCTCAGGGAATCTGG + Intronic
1181394013 22:22605081-22605103 TGGCTCCAGCTCAGGGAACATGG + Intergenic
1181423778 22:22819653-22819675 TGGCTCCAACTCGGGGAACACGG + Intronic
1181571232 22:23768594-23768616 TCGGGCCGGCCCGGGGAATCCGG - Intronic
1182521650 22:30888068-30888090 TGGCCGCAGCCCAGGGAATCAGG + Intronic
1183834981 22:40444865-40444887 TGGCACCAGCTTGGGCAATGTGG + Intronic
1184102001 22:42345625-42345647 TGGAGCCAGCTCTGGGATGCAGG - Intergenic
950787849 3:15450728-15450750 TGGCCCTAGATCGGGGACTCAGG + Exonic
952959237 3:38579434-38579456 TGGCTCCAGGTCCTGGAATCCGG + Exonic
957601145 3:82337329-82337351 TGGCGCCATCTCGGCAAATGCGG - Intergenic
966945201 3:184772979-184773001 TGGCGCCAGCTCGGGGAATCAGG - Intergenic
966985972 3:185180849-185180871 TCGCAGCAGCTGGGGGAATCTGG - Intergenic
967507358 3:190268104-190268126 TAGCGCCAGGTGGGGGAAACAGG - Intergenic
968657371 4:1784492-1784514 TGGAGCCAGGTCGGGGCATGTGG + Intergenic
976239469 4:82939581-82939603 TGGCACCAGCTCCGGGAACAGGG - Exonic
978776217 4:112509535-112509557 CGGCGCCTGCCCGGGTAATCAGG + Intergenic
982646776 4:158033738-158033760 TGCCGCCAGCTGGGAGATTCAGG + Intergenic
1002896204 6:1381984-1382006 TGGCGCCACCCCGCGGAAGCCGG + Intergenic
1003171989 6:3727204-3727226 TGTCCCCATCTCAGGGAATCAGG + Intronic
1005928977 6:30466642-30466664 TGGAGCCAGCTGGGGGAGGCGGG - Intergenic
1018903791 6:168063840-168063862 TGGCACCAGCTGTGGGAGTCTGG - Intronic
1022952549 7:35352329-35352351 TGGCCCCAGCTGGGGGAACTTGG - Intergenic
1030138906 7:106285255-106285277 AGACGCCAGCTCTGGGAAGCTGG + Intronic
1032030517 7:128479248-128479270 AGGTGCCAGCTCAGGGAATTCGG - Exonic
1035315266 7:157993620-157993642 TGGAGCCAGGGCGGGGACTCAGG - Intronic
1037918157 8:22785336-22785358 TGGGGCCACCTATGGGAATCTGG + Intronic
1039471380 8:37815547-37815569 GGGCCCCAGCTCTGGGAATGAGG - Intronic
1045339407 8:101239557-101239579 TGGCTCAAGCTCAGGCAATCAGG + Intergenic
1052403028 9:28024801-28024823 TGGCTCCACGTCGGGGAAGCTGG - Intronic
1052807430 9:33025407-33025429 TGGCGCCAGCCAGGGGACTAGGG - Intronic
1061246422 9:129403150-129403172 TGGTGCCAGATCGGGGAAGAGGG - Intergenic
1062122033 9:134839031-134839053 TGGCCCGAGTTCGGGGCATCAGG - Intronic