ID: 966946960

View in Genome Browser
Species Human (GRCh38)
Location 3:184783545-184783567
Sequence TAGAATAAACTGGAGGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966946952_966946960 26 Left 966946952 3:184783496-184783518 CCAAAGAAAGTTTGGGTGAAAAT No data
Right 966946960 3:184783545-184783567 TAGAATAAACTGGAGGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966946960 Original CRISPR TAGAATAAACTGGAGGATGG GGG Intergenic
No off target data available for this crispr