ID: 966961570

View in Genome Browser
Species Human (GRCh38)
Location 3:184944991-184945013
Sequence CTGTAGGCACTCATTGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966961570_966961574 1 Left 966961570 3:184944991-184945013 CCTACTTCAATGAGTGCCTACAG 0: 1
1: 0
2: 4
3: 12
4: 101
Right 966961574 3:184945015-184945037 GGCCAAGGTGATTGTTAATTTGG 0: 1
1: 0
2: 0
3: 9
4: 94
966961570_966961576 6 Left 966961570 3:184944991-184945013 CCTACTTCAATGAGTGCCTACAG 0: 1
1: 0
2: 4
3: 12
4: 101
Right 966961576 3:184945020-184945042 AGGTGATTGTTAATTTGGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966961570 Original CRISPR CTGTAGGCACTCATTGAAGT AGG (reversed) Intronic
902070457 1:13730584-13730606 CTGAAAGCATTCATTGAAGTGGG + Intronic
903747842 1:25600541-25600563 CAGTAGGTACTGATTGAAGGAGG - Intergenic
903751266 1:25622425-25622447 ATGTAGCCATTCATTAAAGTAGG - Intronic
906296951 1:44654781-44654803 CTGTAGCCTGTCATAGAAGTGGG + Exonic
906869030 1:49456016-49456038 CAGTAGGCTCTCTTGGAAGTTGG - Intronic
911666092 1:100554356-100554378 CTTTATCCACTCATTGAAATGGG + Intergenic
914446948 1:147758423-147758445 CTCCAGGCACTGATTAAAGTCGG + Exonic
914978401 1:152389129-152389151 TTGCAGGCACTCTTTGCAGTGGG - Intergenic
921557698 1:216618840-216618862 ATGTAGGCACTCAGAGAAGATGG + Intronic
922698004 1:227741333-227741355 ACGCAGGCACTCATGGAAGTGGG + Intronic
1066208545 10:33213542-33213564 TTGGAGCCACTCATTGATGTAGG + Exonic
1075932851 10:126314007-126314029 CTGTAGGCACTCACGGATGGAGG + Intronic
1083010351 11:59391478-59391500 CTCTAGCCACTCCATGAAGTAGG - Intergenic
1083983107 11:66190789-66190811 CTGTGGGCAGTCATTGAAGGGGG + Intronic
1084898096 11:72290239-72290261 CAGTGAGAACTCATTGAAGTTGG - Intergenic
1088649722 11:111946718-111946740 CAGCAGGAACTCATTGAAGTCGG + Intronic
1089051667 11:115550897-115550919 CTGTATTCACACATTCAAGTCGG - Intergenic
1098051236 12:66455516-66455538 CTGTATGCACTCATGGAGGTAGG + Exonic
1099376295 12:81899108-81899130 CTGTAGCCACTCAAGGAAGGTGG - Intergenic
1100530191 12:95455335-95455357 CTGTAGTCACTCAAGGAAGGCGG + Intergenic
1102057976 12:109910997-109911019 CTGTAGGCTCTCATTGCAGAAGG + Intronic
1103602952 12:122065601-122065623 CTGCAGGGACTCAGTGAAGGAGG + Intergenic
1109444969 13:62424544-62424566 CTGTAGGCAGGCCTTGTAGTTGG + Intergenic
1111990481 13:95111651-95111673 ATGTTGGCACTCATTGCAGATGG - Intronic
1112378676 13:98867763-98867785 CTGAAGTCCTTCATTGAAGTAGG - Intronic
1117041824 14:51774984-51775006 CAGCAGGCACTCAATGAATTGGG + Intergenic
1119863409 14:77953626-77953648 CAGTAGGCACACATTTGAGTTGG - Intergenic
1125070510 15:35547938-35547960 CTGTAGAGACACATGGAAGTGGG + Intergenic
1129487118 15:75885097-75885119 CTGTAAGCACTAATAGTAGTGGG + Intronic
1129580813 15:76807972-76807994 CTGTTGGGAATCATAGAAGTTGG - Intronic
1131546833 15:93322642-93322664 CTGTAGGGAGCCATTGAACTGGG - Intergenic
1139259888 16:65581219-65581241 CTGTAGATACACATTGAGGTTGG + Intergenic
1144321206 17:14122062-14122084 CAGTAGGGAGCCATTGAAGTGGG + Intronic
1144609492 17:16697174-16697196 CTGTAGGGACTCATTGGAGTGGG + Intronic
1144903280 17:18618377-18618399 CTGTAGGGACTCATTGGAGTGGG - Intergenic
1144927787 17:18827608-18827630 CTGTAGGGACTCATTGGAGTGGG + Intergenic
1145129292 17:20328375-20328397 CTGTAGGAACACATTGGAGTGGG + Intergenic
1145195367 17:20889260-20889282 CTGTAGGGATTCATTGGAGTGGG - Intronic
1145758853 17:27413815-27413837 CTGTAGATACTCAGTGAATTTGG - Intergenic
1148178520 17:45586852-45586874 CTGCAGGCACTCATTGAGTCTGG + Intergenic
1149630285 17:58116345-58116367 CTCCAGGCACGCATTGAGGTAGG + Intergenic
1151298278 17:73201959-73201981 CTGAAGGAACTGATTGAGGTTGG - Intronic
1152480207 17:80545803-80545825 CTGAAGGCACCCCTTGAACTTGG + Intronic
1153381211 18:4441456-4441478 CTGGAAGAACTCATTGAAGTAGG + Intronic
1155416615 18:25605760-25605782 CACTCGGCACTCACTGAAGTTGG - Intergenic
1164777881 19:30868360-30868382 CTCTAGGGACTCGTGGAAGTTGG + Intergenic
1164855067 19:31514401-31514423 CTGTATGCACTCCCTGAAGCTGG + Intergenic
1165937393 19:39397683-39397705 CTGGGGGCACTCTGTGAAGTGGG + Exonic
925299407 2:2800030-2800052 CATTAGGCACTCAGTGAAGTTGG + Intergenic
925304930 2:2841438-2841460 CTGTAAGCCCTCAGTGCAGTTGG - Intergenic
931736761 2:65201536-65201558 ATGTAGGCACTTATTGCTGTAGG - Intergenic
931882329 2:66580810-66580832 CTGTAATCAATCATTGAAATAGG - Intergenic
936681815 2:114782504-114782526 CTGAAGGCACCCATTTGAGTAGG + Intronic
938737988 2:134203835-134203857 CTTTAGGCACTTGTTTAAGTTGG + Intronic
939422329 2:141988901-141988923 CAGTAGGCACTTATTTATGTTGG - Intronic
939448987 2:142348154-142348176 CTGCAGGAAGTCAATGAAGTGGG - Intergenic
940917933 2:159278144-159278166 TTGTAGGCACTCAATGAATGTGG - Intronic
943265208 2:185722084-185722106 CTGTAGTCACTCTTTGCTGTAGG + Intergenic
947628071 2:231633536-231633558 CAGCACCCACTCATTGAAGTTGG + Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1170200136 20:13733612-13733634 ATGTAACCACTCACTGAAGTAGG - Intronic
1170760947 20:19251227-19251249 GTGTAGCCACTCACTGATGTTGG + Intronic
1174064503 20:47854801-47854823 CTGGAGGCACTCACTGAAGCGGG - Intergenic
1174642788 20:52059581-52059603 TTGTAGTCAGTCATTGGAGTTGG - Intronic
1177135097 21:17299445-17299467 CTGTAGCCACTCAAGGAAGGTGG - Intergenic
1183692164 22:39396612-39396634 GGGTAGGGACTCATTTAAGTGGG - Intergenic
949413087 3:3786919-3786941 CCATCGGCACTCATTGAAGATGG - Intronic
950568465 3:13785820-13785842 CTGAAGGCACTCATTTAGTTGGG + Intergenic
952385722 3:32840299-32840321 ATGTAGGCACTCTTTTAAATAGG + Intronic
952968820 3:38637856-38637878 CTGTAGGCACTGTCTGAAGTGGG + Intronic
953497592 3:43401903-43401925 CTGTAGTCACTCAAGGGAGTGGG + Intronic
955198752 3:56830488-56830510 CTGTAGGCACTGGTTGCAGCAGG - Intronic
956894474 3:73645698-73645720 CTGTTGGCAATCCTTGAACTAGG - Intergenic
961961085 3:130855858-130855880 CTGCAGGGACACATAGAAGTGGG - Intronic
966961570 3:184944991-184945013 CTGTAGGCACTCATTGAAGTAGG - Intronic
967365916 3:188686365-188686387 CTGTGGGGACTAACTGAAGTGGG - Intronic
972721000 4:41698293-41698315 GAGTAGGTATTCATTGAAGTGGG - Exonic
972808911 4:42561580-42561602 ATGAAGCCACTCATTGGAGTGGG - Intronic
976708226 4:88041300-88041322 CTGAAGTCACTCAGTGAAGATGG - Intronic
977345683 4:95813218-95813240 TCCTAGGCACTCATTCAAGTTGG + Intergenic
980011771 4:127603795-127603817 TTGTTGGCTCTCATTGAAATGGG - Intergenic
983716895 4:170792984-170793006 CTGTAGGCACTTTTTGAAAATGG + Intergenic
983789218 4:171774652-171774674 CTGTCTTCACTCATTTAAGTCGG - Intergenic
984461530 4:180043247-180043269 ATGTAGGAACTCTTTGCAGTAGG + Intergenic
985200418 4:187478911-187478933 CTGTTGGCACACAGTGAAGCCGG - Intergenic
986179511 5:5380431-5380453 CTGAAAGCACCCATTGATGTTGG - Intergenic
988077112 5:26367240-26367262 CTGTAGGCACTAATTGTGGTTGG + Intergenic
993050231 5:82918023-82918045 CTGGAGGCACCAAATGAAGTTGG - Intergenic
993937451 5:94021733-94021755 CTTAAGGAACTCATTAAAGTAGG + Intronic
993955870 5:94232132-94232154 TTGTAGGCATTCATTTAAGAAGG + Intronic
998721608 5:144958000-144958022 CTGAAGGCATTTGTTGAAGTTGG - Intergenic
1000147027 5:158463321-158463343 CTGTAGGAAGTCAATGAATTGGG - Intergenic
1000431870 5:161162126-161162148 CTGTAGCCACTCACTGAAGTTGG + Intergenic
1004566500 6:16803153-16803175 TAGTGGGCAGTCATTGAAGTAGG + Intergenic
1011703296 6:89975538-89975560 CAGTAGGTACTCAATAAAGTTGG + Intronic
1013858946 6:114610290-114610312 CTGTAGTCATTCATTTAAATTGG + Intergenic
1014293393 6:119587836-119587858 CTGTAGGCACACCTTGAATATGG - Intergenic
1014371540 6:120615249-120615271 CTGTAGATACTCAATGTAGTTGG + Intergenic
1015097521 6:129433206-129433228 ATGCAGGCAATCATTGAATTTGG - Intronic
1018500816 6:164409532-164409554 TTGAAGGCTCTCAGTGAAGTGGG - Intergenic
1024100386 7:46026773-46026795 CTATAGGTTCTCATTGCAGTGGG + Intergenic
1028094828 7:86747052-86747074 CTCTAAGCACTCATAGGAGTTGG + Intronic
1028298869 7:89171246-89171268 TTGTAGTAACTCAATGAAGTAGG + Intronic
1028755496 7:94428824-94428846 CAGTAGGCATTCAGTAAAGTTGG - Intronic
1030404250 7:109090264-109090286 CTGTAACAACTCCTTGAAGTAGG + Intergenic
1032259142 7:130320788-130320810 CTTTAAAAACTCATTGAAGTAGG - Intronic
1034502753 7:151461469-151461491 CTCTAGGAAGTCATTGAGGTAGG + Intergenic
1039224486 8:35372959-35372981 AGTTTGGCACTCATTGAAGTGGG - Intronic
1043456057 8:80413133-80413155 CTATAGACACACTTTGAAGTTGG - Intergenic
1048353588 8:133635350-133635372 CTGTAGGCACTCAGTAAATACGG - Intergenic
1051698838 9:19797240-19797262 CAGTAGGCACTCATTGTTCTAGG - Intergenic
1058562146 9:106241583-106241605 CACAAGGCACTCATTGAAGCAGG - Intergenic
1062585894 9:137249853-137249875 CTGGAGCCACTCATAGAACTAGG - Intergenic
1187258454 X:17662181-17662203 CTGTGGGCACACACAGAAGTGGG + Intronic
1188876473 X:35436547-35436569 CTGTAGGCATCCATTGAATGTGG + Intergenic
1190415977 X:50180801-50180823 CTGCAGGCTCTCATTGATGGAGG - Intergenic
1198831955 X:140760197-140760219 GTCTAAGCACTCATTGAACTGGG + Intergenic
1199886943 X:152029726-152029748 CTGTTTGCATTCATTGAAATGGG - Intergenic