ID: 966963302

View in Genome Browser
Species Human (GRCh38)
Location 3:184963338-184963360
Sequence GCCTTTTCTGCTCTTTGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 220}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966963302 Original CRISPR GCCTTTTCTGCTCTTTGGTG AGG Intronic
905055002 1:35085694-35085716 GCCCTTTCTTGCCTTTGGTGTGG + Intronic
905900948 1:41581669-41581691 GCATTTTCTTCTCTCTGGCGGGG + Exonic
906791693 1:48664107-48664129 CCCCTCTCTGCTCTTTGGTCTGG - Intronic
906864753 1:49405631-49405653 TCCTTTTCTTCCCTTTGATGAGG + Intronic
907935141 1:59035097-59035119 GCGATTCCTTCTCTTTGGTGCGG - Intergenic
909158015 1:72105443-72105465 GCAATTCCTGCACTTTGGTGGGG + Intronic
909365897 1:74821603-74821625 GCCTTTTATCCTCTTTATTGTGG + Intergenic
910440887 1:87250646-87250668 CCTTTTTCTGCTCTTTGGCCAGG - Intergenic
910659678 1:89658052-89658074 ACCTATTCTGCTCTTGGATGTGG - Intronic
912624788 1:111197988-111198010 GCCTTGTCTGCTCTTTCTTAGGG - Exonic
914850065 1:151307708-151307730 GTGTTTTCTGCTCTTTGGTGGGG + Exonic
916782801 1:168054000-168054022 GCTGTTTCTGCTCCTTTGTGGGG - Intronic
923029951 1:230241209-230241231 GACTTTTTTTCTCTTTGATGTGG + Intronic
923678888 1:236103130-236103152 GCTGACTCTGCTCTTTGGTGTGG + Intergenic
924294164 1:242568753-242568775 TCTTTTCCTGCTCTTAGGTGTGG + Intergenic
924592643 1:245418190-245418212 TCCTTTGCTGCTGTGTGGTGCGG - Intronic
1063021937 10:2137632-2137654 GCCTTTTCCTCTCCCTGGTGAGG + Intergenic
1063956158 10:11269642-11269664 GCCTCTTCTCCTCCTTTGTGTGG - Intronic
1067672288 10:48334047-48334069 GCCTCTGCTCCTCTTTGCTGGGG + Intronic
1070827506 10:79399722-79399744 GCCTTCTCTGCTCCTTGGCTTGG - Intronic
1072798425 10:98374526-98374548 GCTTTTTCTGTCCTCTGGTGGGG + Intergenic
1072989190 10:100174413-100174435 GCCTTTTCTTCCCTTTTGTGTGG + Intronic
1075787494 10:125059884-125059906 GGCTTTGCTGATCTTTTGTGGGG + Intronic
1076195090 10:128512131-128512153 GCCTTCTCTGCTATCTGGAGGGG + Intergenic
1077221300 11:1418641-1418663 GCTGTTTCTTCTCTTTGGAGGGG + Intronic
1077745169 11:4895436-4895458 TGCTTTTCTGTTCTTTGCTGGGG + Intronic
1079292361 11:19199740-19199762 GCCTTTTCTGAGCTTTACTGTGG - Intronic
1079296325 11:19237904-19237926 CCCTTTTCTGATCTCTGTTGCGG + Exonic
1081524552 11:43917076-43917098 CCCTTGTCTGCTTTTTGGTATGG + Intronic
1083036501 11:59642387-59642409 GCCTTCCCTGCACTTAGGTGTGG + Intronic
1083153878 11:60810723-60810745 GCCTTTCCTGCTCGTTGGAGGGG - Intergenic
1084678269 11:70649552-70649574 GCCTTTGGTGCCCTTTCGTGGGG - Intronic
1084744740 11:71162040-71162062 GCATTTTCTGCTTTTTGTTCTGG + Intronic
1088506213 11:110530044-110530066 GGCCTCTCTGCCCTTTGGTGGGG + Intergenic
1088576571 11:111277870-111277892 CCATTTTCAGCTCTGTGGTGTGG - Intronic
1089695163 11:120212064-120212086 GCCCTGTCTCCTCTTTGGTCTGG + Intronic
1092859535 12:12708613-12708635 GCCTTCTCTGCTCTCTTTTGTGG + Intergenic
1095345270 12:41142469-41142491 GCCTCTTCAGCTCTTGTGTGTGG - Intergenic
1097242077 12:57582396-57582418 CCCTTTTCCTCTCCTTGGTGAGG + Intronic
1097618143 12:61907935-61907957 GCCATTTCTGCTATTTGGAATGG + Intronic
1104038589 12:125114985-125115007 GCCTGTGCTGCACTGTGGTGAGG + Intronic
1104931561 12:132341890-132341912 GGCCTTTCTGCTCTGCGGTGAGG - Intergenic
1106088557 13:26564985-26565007 GGCTTTGCAGCTCTTTGCTGGGG + Intronic
1106780452 13:33054040-33054062 GACTTTTTTGCTCTTTGCTTTGG + Exonic
1107431956 13:40348276-40348298 GCCTCTTCTGTTCTTTGCTCTGG - Intergenic
1108209898 13:48127508-48127530 GGCTTTTCTGGTCTTTAATGAGG - Intergenic
1110360806 13:74622777-74622799 GCCTTTTCAGCCCATTAGTGTGG + Intergenic
1110443284 13:75549259-75549281 GCCTTGTCTGCTCTTGCGGGAGG - Intronic
1110978246 13:81867021-81867043 CCCTTTTCTGCTTTTTTGGGTGG + Intergenic
1112873217 13:104001329-104001351 GCCTTTTCTGCTCTCTGGGATGG + Intergenic
1112954837 13:105044108-105044130 GCCTTTTTTGATCTGTGTTGTGG - Intergenic
1115271833 14:31561454-31561476 GCGTCTGCTGCTTTTTGGTGGGG + Exonic
1116009404 14:39333327-39333349 GCCTTTTCCCTTCTGTGGTGGGG + Intronic
1120264271 14:82229456-82229478 GCCTTTTCTCCTTTATGTTGAGG - Intergenic
1121282677 14:92710673-92710695 GCCATTTCTGATCTTGGTTGAGG - Intronic
1121633740 14:95439832-95439854 GAGGTTTCTGCTCCTTGGTGTGG + Intronic
1124139066 15:27061690-27061712 GACTTTTTTTCTCTTTGGTGGGG - Intronic
1125614892 15:41001975-41001997 GCATTTTCCGCCCTTTGGAGGGG + Intronic
1125882656 15:43207798-43207820 GCCATTTCTGTTCCTGGGTGAGG + Intronic
1126424568 15:48513130-48513152 GCCCTTGCTGCTTTTTAGTGTGG - Intronic
1128105173 15:65039002-65039024 GGCTGTTCTGCTCCTTGGGGTGG - Intergenic
1128610249 15:69067345-69067367 TCCCTTCCTGGTCTTTGGTGGGG - Intergenic
1129021090 15:72519045-72519067 TCTTGTTCTGCTCTTTGGTTTGG + Intronic
1129945079 15:79532782-79532804 GCCTTTTCTTCTCCTTGTTTCGG - Intergenic
1130435841 15:83898596-83898618 CCCATTTCTGCTCTTTCATGTGG - Intronic
1130750539 15:86707627-86707649 GGCTTTGCTTTTCTTTGGTGTGG - Intronic
1133268669 16:4600004-4600026 GGCTTCTCTTCTCTTTAGTGGGG + Intronic
1133490250 16:6261232-6261254 GACTTTTCTGCTTTTTGGAAGGG - Intronic
1135507026 16:23047761-23047783 GCCTTTTGTGATTTTAGGTGTGG + Intergenic
1137376031 16:47952576-47952598 GCCTTTCCTGCTGTTAGGGGAGG + Intergenic
1137926334 16:52546070-52546092 GCCTTTGCTGCCCTTTCGTTAGG - Intronic
1138110147 16:54317415-54317437 GCCTTATCTGCTCTCCGGAGCGG + Intergenic
1138787981 16:59869115-59869137 GCCTTTTCAGCTCCTGTGTGTGG - Intergenic
1141802720 16:86322179-86322201 CCCTTTTCTTTTCTTTGATGGGG + Intergenic
1143776194 17:9200482-9200504 GCCTTTTCTGCAATTTGGAAGGG + Intronic
1144740769 17:17580949-17580971 GCCCTTTCTCCTCTTTGGCTTGG - Intronic
1144771613 17:17762675-17762697 GTCATTTCTGCTCTGTGGTGGGG + Intronic
1145911634 17:28546697-28546719 TCCTTTTCTGTTCTCTGGTGTGG - Exonic
1149621636 17:58049751-58049773 GGCTGTTCTGCCCCTTGGTGCGG + Intergenic
1150632735 17:66891451-66891473 GGCTTCCCTGCTCATTGGTGTGG + Intergenic
1151276686 17:73039821-73039843 GCCTTTTCTTCTGTTAAGTGAGG - Intronic
1151717526 17:75838799-75838821 GCCTTTGCTGCTTTTTTGAGTGG - Intronic
1153112779 18:1612266-1612288 GCCTTATCTGTTCTTTGTAGTGG + Intergenic
1156361483 18:36388110-36388132 GCCTTTTTGCCTTTTTGGTGTGG + Intronic
1156911694 18:42417904-42417926 GGCTTTTCAGCTCGTAGGTGGGG + Intergenic
1156981618 18:43295688-43295710 GCCATCTATGCTCTTTGGTGAGG + Intergenic
1157443812 18:47729930-47729952 GCCTTTCCTGCTCTCTGTCGGGG + Intergenic
1159110021 18:64044568-64044590 GCCTTTTCTGGTCTTTGATCAGG - Intergenic
1160070701 18:75625380-75625402 CCATTGTCTGCTTTTTGGTGTGG + Intergenic
1161531272 19:4791640-4791662 TCCTTTTCTGTTCTATGGAGTGG + Intergenic
1162251652 19:9449667-9449689 GCCTTTTCAGTTCTTAAGTGGGG - Intergenic
1164511238 19:28898909-28898931 GCCTTGTCTGCACTTTTGAGTGG + Intergenic
1165166413 19:33860329-33860351 GCCTTTGCTTGTCTTCGGTGGGG + Intergenic
1168267676 19:55231350-55231372 GTCTTTTCTCCTCTTCGCTGAGG - Intronic
1168669628 19:58230759-58230781 GCCTCTTCTCCTCTCAGGTGAGG - Intronic
925640093 2:5978978-5979000 GGCTTTTCTAGTCTTGGGTGGGG + Intergenic
926004747 2:9365188-9365210 TCCTTTTGTGCTCTTTGCTTTGG + Intronic
926223492 2:10951557-10951579 TCCTTTGCTCTTCTTTGGTGTGG + Intergenic
926276942 2:11411086-11411108 GAATTTTCTGCTCTTTTGGGCGG + Intergenic
926772860 2:16393634-16393656 GCTTTTTCTTCTCCCTGGTGCGG + Intergenic
927305507 2:21567203-21567225 GGCTTTTCTGCTTTTTGTTTTGG + Intergenic
927698973 2:25255880-25255902 GGCGTTGCTGCTCTTTGGAGAGG - Intronic
930619997 2:53633762-53633784 TGCTTTTGTGCTCTTTGCTGTGG - Intronic
930677795 2:54222869-54222891 GCATTTTCTGAGTTTTGGTGAGG + Intronic
932437412 2:71710752-71710774 GCCTTTTCAGCTCTTTGCCCTGG + Intergenic
932643265 2:73473223-73473245 GTCTTTTTTGCTCTGTGTTGGGG - Intronic
935505962 2:103903294-103903316 TCCTTTTCTGCTGTTGGGTGGGG + Intergenic
935507434 2:103923111-103923133 GCCTTTACTCCTGTTTGATGTGG - Intergenic
936858358 2:116987079-116987101 GGCTTTTCAGCTCTAAGGTGGGG - Intergenic
937258857 2:120572819-120572841 GCCTCTCCTTCTCCTTGGTGCGG - Intergenic
938705676 2:133923318-133923340 GGCTTTTCTGATCTTTGTTTTGG - Intergenic
940767750 2:157808326-157808348 GCCTTGGCTACACTTTGGTGTGG + Intronic
943455781 2:188104885-188104907 GTCTTTTCTGATCTTTGTTGAGG - Intergenic
945502097 2:210589058-210589080 GCTTTTTCTGTGCTTTGGTTGGG - Intronic
945805122 2:214480802-214480824 GCCTTTTATTCTGTTAGGTGTGG - Intronic
946277165 2:218640251-218640273 TCCTTTTCTTCTCCTGGGTGTGG - Intronic
946500127 2:220238369-220238391 GGCTTTTCTTTCCTTTGGTGAGG + Intergenic
946770074 2:223080067-223080089 CCCTTTTCTCCTTTTTTGTGAGG - Intronic
1169532455 20:6500521-6500543 GCTTTTTCTTCTCATTGGTCTGG + Intergenic
1172519666 20:35558598-35558620 CCCTTTTCTTCCCTGTGGTGGGG + Intergenic
1172998609 20:39089676-39089698 GCCTGTTCTGTTTCTTGGTGGGG + Intergenic
1173206535 20:40999013-40999035 GCTTTTTCTCCTCTTTAGTATGG - Intergenic
1173342822 20:42168461-42168483 GCCTTTTCTAGTATTTTGTGAGG - Intronic
1173547578 20:43910752-43910774 GCCTTGTCTGCTCCTTCCTGCGG + Intergenic
1175884495 20:62281515-62281537 GCCTTTTCACCACTTTAGTGAGG + Intronic
1177587793 21:23120621-23120643 CCCTTTTCTGCTGTTTGGAATGG - Intergenic
1178505561 21:33159958-33159980 GCCTGTTTTGCTGTTAGGTGTGG - Intergenic
1181491279 22:23262336-23262358 GAGTTTTCTGCTCTGAGGTGTGG + Intronic
1183007784 22:34917585-34917607 TGCTTTTCTCCTCTTTGCTGAGG - Intergenic
1183365310 22:37403656-37403678 GCCTTTTCTGCCTTTTCCTGTGG - Intronic
1183531348 22:38355404-38355426 GCTATATCTCCTCTTTGGTGGGG + Intronic
1184973341 22:48043364-48043386 GCATTTTCTGCACTCAGGTGGGG - Intergenic
949470587 3:4391780-4391802 GCCCTCTCTGCTCATTGGTTTGG + Intronic
949946489 3:9193757-9193779 GCCATGTCTGATCTGTGGTGTGG - Intronic
950187800 3:10956145-10956167 GCCATTCCTGCACTTTGTTGAGG + Intergenic
950216332 3:11162336-11162358 GCATTTTCCTCTCCTTGGTGGGG + Intronic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
950616037 3:14158788-14158810 TCCTTTGCTGGTCTTTGGTTTGG + Exonic
950703470 3:14766181-14766203 GCCTTTTCTCCTTTCTTGTGTGG + Intronic
952723632 3:36558996-36559018 TCTGTTTCTGCTGTTTGGTGTGG - Intergenic
953080367 3:39611078-39611100 TCCTTTTCTTCTCTGTTGTGTGG - Intergenic
954326831 3:49868594-49868616 CCCTTTTCTAATATTTGGTGTGG - Intronic
956365423 3:68496783-68496805 TCATTTTCTTCTCTATGGTGGGG + Intronic
957120466 3:76084094-76084116 CACTTTTGTGCTCTTTCGTGAGG + Intronic
957352136 3:79038880-79038902 GCCTTTTCTGCTCTTGATTTGGG - Intronic
961699975 3:128735845-128735867 GCCTTTTTTTCTTTTTGGTAAGG - Intronic
962372414 3:134831605-134831627 ACCTTTTCTCCACTTTGGTTAGG + Intronic
962818117 3:139020612-139020634 GCCTTCCCTGCTCCCTGGTGGGG - Exonic
963371492 3:144406863-144406885 ACCTTCTCTGTACTTTGGTGTGG + Intergenic
963688342 3:148466448-148466470 CCCTTTTCTTCACTGTGGTGTGG + Intergenic
963772993 3:149408480-149408502 GCTTTTTCTGCTCTTTTCTTGGG - Intergenic
964941158 3:162158828-162158850 CCCTTTTCTGCTCTTCTGGGGGG - Intergenic
966963302 3:184963338-184963360 GCCTTTTCTGCTCTTTGGTGAGG + Intronic
967493633 3:190120387-190120409 CCCTTTTCCGCTCCTTGTTGGGG - Exonic
969112272 4:4851506-4851528 ATCTCTTCTGCTCTCTGGTGTGG - Intergenic
969461894 4:7333424-7333446 TCCTCTTCTGCTCTGTTGTGGGG + Intronic
969565095 4:7972631-7972653 GCCTGTCCTGCTCTCTGCTGTGG + Intronic
970852693 4:20620206-20620228 ACCTTTTTTGCCCTTTTGTGGGG + Exonic
971498686 4:27295322-27295344 GCATCTTTTGCTCTTTGGTTAGG + Intergenic
975835466 4:78418297-78418319 GCCTTTTTTGGTGTTTGGGGTGG + Intronic
976459112 4:85287023-85287045 GCCTATTTTGCTCCTTGGAGTGG - Intergenic
977166777 4:93710072-93710094 GCCTTTTAGTCTGTTTGGTGAGG + Intronic
977262090 4:94809652-94809674 CTCTTTTCTACACTTTGGTGGGG - Intronic
982303813 4:153907477-153907499 GCCTATTCTACTGTTTGGTTGGG - Intergenic
983721891 4:170865522-170865544 GGCATGTCTGCTCTTTAGTGTGG + Intergenic
983913179 4:173263138-173263160 GCCCTTTCTGAAGTTTGGTGAGG - Intronic
984002196 4:174262999-174263021 TCCTGCTCTGCTCTCTGGTGAGG + Exonic
985126307 4:186698283-186698305 GCCTTTGCTTCTCTTCGCTGCGG - Intronic
985356400 4:189124124-189124146 GTCCTTTCTGCTCTTGGGTGTGG - Intergenic
987123986 5:14793804-14793826 GCCTTGTTTGCTCTCTCGTGGGG + Intronic
987949911 5:24661205-24661227 GTCTTTTCTCTTCTCTGGTGGGG - Intergenic
989704568 5:44313334-44313356 AGTTTTTCTGTTCTTTGGTGAGG + Intronic
990687561 5:58323271-58323293 GAAGTTTCTGCTCATTGGTGAGG - Intergenic
990802273 5:59618445-59618467 GCCTGTTCTGTTCTTTTGTCAGG - Intronic
995131233 5:108632728-108632750 GCCTTCTCTGCTCTTGACTGAGG + Intergenic
995869618 5:116730832-116730854 GCTTTTTTTCCTCTTTGCTGGGG - Intergenic
996623619 5:125541323-125541345 GTCTTTCCTGCTGTTTGGTGGGG + Intergenic
999103547 5:149048640-149048662 GCCTGTTTTGTTCTTTGCTGAGG - Intronic
1001000149 5:167998004-167998026 GCTTTTTCTACTTTTTGGTTTGG - Intronic
1001061300 5:168491365-168491387 TCCTTTTCTCTTCTTTGTTGGGG - Intronic
1001467257 5:171978489-171978511 GCCTTTGCTGCTTTGAGGTGGGG - Intronic
1001875720 5:175198564-175198586 TCCTGTTCTCCTCTGTGGTGGGG - Intergenic
1002064433 5:176645037-176645059 GCCTTATCCGCTCTCTGCTGAGG - Intronic
1002171881 5:177379273-177379295 GCCTTGCCTGCTCTGTGCTGGGG + Intronic
1002992903 6:2254486-2254508 GCGCTTACTGCTTTTTGGTGAGG - Intergenic
1006226714 6:32543983-32544005 GTGTATTCTGCTGTTTGGTGTGG + Intergenic
1006247665 6:32754297-32754319 GTCTTTTCTGCTGTTAGGTTGGG - Intergenic
1006284710 6:33083766-33083788 GCCTTTTCTGCTTTCTGAGGAGG + Intronic
1006874261 6:37281715-37281737 TCCTTATGTGCTCTGTGGTGTGG + Intronic
1007011116 6:38418416-38418438 TCCTTTTTTTCTCTTTGGTGGGG - Intronic
1007116261 6:39345380-39345402 CCCTGCTCTGCTCTGTGGTGGGG + Intronic
1009934994 6:70223675-70223697 TCGTTTTCTGCGCTTTGGCGCGG - Intronic
1013675067 6:112450019-112450041 GTATTTTCTGCTGTTTAGTGGGG + Intergenic
1015723088 6:136266404-136266426 GCATTTTCTGCTGTTTGGCATGG - Intronic
1017420589 6:154268293-154268315 GTCCTGTCTGCTCTTTGGAGTGG + Intronic
1017424030 6:154302471-154302493 TTCTTTTCTTCTCTTTAGTGGGG + Intronic
1019669873 7:2271768-2271790 GCCTTTTCCTCTCTCAGGTGTGG - Intronic
1020935709 7:14461133-14461155 ACCTTTCCTGCTCTTTCCTGTGG - Intronic
1024945090 7:54800171-54800193 GCCTTTTCTGTACTCTGCTGTGG + Intergenic
1025953983 7:66168633-66168655 GCCTTTTTTTTTTTTTGGTGGGG + Intergenic
1030080533 7:105774072-105774094 GCCTTAGCTGCTCTTTGAGGTGG - Intronic
1031053738 7:116971730-116971752 ACCTTTTCTTCTCTATGGAGCGG + Intronic
1031071265 7:117164834-117164856 GCCTTTATTGTTTTTTGGTGGGG + Intronic
1033004564 7:137547704-137547726 CCCTTCTCTGCTCTGTGGGGAGG - Intronic
1033260073 7:139836102-139836124 GGCTTTTCAACTCTTTGGTTAGG - Intronic
1034022400 7:147659109-147659131 GTCTTTTCTACTCTTTGGAAAGG - Intronic
1034355648 7:150449097-150449119 GCCTTTTCTTCTCTATTTTGGGG + Intergenic
1035269160 7:157709865-157709887 GCCTTGTCTGCTCACTGATGAGG - Intronic
1035358101 7:158291057-158291079 GGCATTTCTGCTCTGGGGTGGGG + Intronic
1036000889 8:4602324-4602346 TCCTTATCTGCTATTTGGTTTGG - Intronic
1039411715 8:37360382-37360404 AGCTTTTCTGCTCTTTGGTTAGG - Intergenic
1040468263 8:47715143-47715165 GCCTGTTCTGCTTTTTGGGGGGG + Intronic
1041118412 8:54563136-54563158 GACTCTTCTGCTCTGAGGTGTGG - Intergenic
1043233288 8:77830099-77830121 GCCTTTTGAGCTCCTTGGTGAGG + Intergenic
1043746779 8:83883116-83883138 TCTTTTTCTTTTCTTTGGTGTGG - Intergenic
1047050239 8:121103233-121103255 ACCTTTTCTGATGTTTGCTGAGG - Intergenic
1048239950 8:132731608-132731630 GCCTGTTCAGCTCTGTGATGAGG - Intronic
1050305899 9:4305736-4305758 GCCTTTTCTCCTCTGTGTTGTGG + Intronic
1051312806 9:15794475-15794497 GACTTTTCTTTTTTTTGGTGGGG - Intronic
1053340468 9:37322375-37322397 GCCTTTCCTCCTCTTTTGGGGGG - Intronic
1053904878 9:42831583-42831605 TTGTTTTCTGCTCTTTGGGGTGG + Intergenic
1054986854 9:71271641-71271663 TCCTTTGTGGCTCTTTGGTGGGG - Intronic
1056495856 9:87154623-87154645 ACCTTTGGTGCACTTTGGTGTGG - Intronic
1059981679 9:119779159-119779181 GACTTTTCTTCTCTCTGGAGTGG - Intergenic
1060810914 9:126611184-126611206 GCCTTCTCTGGTCTGGGGTGGGG - Intergenic
1061753081 9:132794165-132794187 CCCTTTTCTGCTCTTTCCTAGGG - Intronic
1062150406 9:135015448-135015470 GCCTTTGTTTCTCTTGGGTGTGG - Intergenic
1186685283 X:11919050-11919072 GACTTTTCTGCTACTTGCTGTGG + Intergenic
1188970099 X:36605038-36605060 GCTGATTCTGTTCTTTGGTGAGG - Intergenic
1190055894 X:47180751-47180773 GCATTCTGTGCTGTTTGGTGGGG + Intronic
1192240414 X:69323746-69323768 ACCTTTCCTGCTATGTGGTGTGG + Intergenic
1193172711 X:78355397-78355419 CCCTTTTCTACTTTTTGGAGTGG + Intergenic
1194113218 X:89864003-89864025 GCCTTATCTCTTATTTGGTGCGG + Intergenic
1194912075 X:99657712-99657734 CCCTTATCTGCTCTTTGGCAAGG - Intergenic
1200070826 X:153528318-153528340 GCCGCATGTGCTCTTTGGTGGGG + Intronic
1200791355 Y:7302442-7302464 GCCTCCTCTGCTGTTTGGGGTGG + Intergenic
1201146845 Y:11069470-11069492 GCCTTTTCTGCTCTGTGCCAGGG - Intergenic
1201148379 Y:11079711-11079733 GCATTTTCTGCTTTTTGTTCTGG + Intergenic
1202034477 Y:20617954-20617976 GCCTTTCCTGCTTTCTGTTGTGG + Intergenic