ID: 966963471

View in Genome Browser
Species Human (GRCh38)
Location 3:184965836-184965858
Sequence CAGTGGCAATGGAGAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 664
Summary {0: 1, 1: 0, 2: 6, 3: 77, 4: 580}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966963465_966963471 27 Left 966963465 3:184965786-184965808 CCATTGCAATGGTACAGGTATGA 0: 1
1: 0
2: 1
3: 8
4: 96
Right 966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG 0: 1
1: 0
2: 6
3: 77
4: 580

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966963471 Original CRISPR CAGTGGCAATGGAGAGAAGA GGG Intronic
901712969 1:11130168-11130190 AAGTGGAAGTGGAGAGAAAAAGG + Intronic
902435397 1:16395319-16395341 CAGTGGGAAGGGGGAGAAGGGGG - Exonic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903210825 1:21817257-21817279 CAGAGGCAAAGGACAGAAGGAGG - Intronic
903275036 1:22216197-22216219 CAGTGGGAATGGGGAGGAGAGGG + Intergenic
903344373 1:22675075-22675097 CTGTGGCAGCGGTGAGAAGATGG - Intergenic
903495455 1:23763528-23763550 CAGAGGCAGTGTACAGAAGAAGG - Intergenic
904309772 1:29621236-29621258 CAGTGGGAATGGGAAGGAGAAGG + Intergenic
904330533 1:29755454-29755476 CAGTGTCTGGGGAGAGAAGATGG + Intergenic
904416144 1:30362140-30362162 CAGTGTCTGGGGAGAGAAGATGG - Intergenic
904770992 1:32881390-32881412 GAGTGGCACTGTGGAGAAGAGGG + Intergenic
904862168 1:33546569-33546591 CAGTGGCACAGGAGAGGAGATGG - Intronic
905544358 1:38785994-38786016 CAATGGGAATGGAGAGGAAAGGG + Intergenic
906043567 1:42809085-42809107 CAGTGGTGATGGAAAGAAGATGG + Intronic
906246628 1:44280365-44280387 CAGTGGAAATGTAGAGAAATGGG - Intronic
906666599 1:47626515-47626537 AAGAGGCAAGAGAGAGAAGATGG - Intergenic
906775605 1:48526895-48526917 CAGGGTCCATGGAGAGATGAAGG - Intergenic
906885654 1:49644213-49644235 TAGTAACAATGGAGACAAGATGG + Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907281750 1:53351581-53351603 CAGCGGGAACAGAGAGAAGAGGG - Intergenic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909579490 1:77218390-77218412 CAGTGGAACTGGAGAGGTGAGGG + Intronic
909799886 1:79793579-79793601 GAGGGGCAATGGAGAGATGTTGG - Intergenic
911401366 1:97379247-97379269 CAGTGACAATGGGGAGAGGCAGG + Intronic
911825152 1:102474028-102474050 CAGTGGGGATAGAGAGAGGAAGG - Intergenic
911856365 1:102882136-102882158 CCTTGGCTATGGAGTGAAGATGG - Intronic
912118110 1:106432776-106432798 AAGTGGCATTGGAAAGAAAAAGG + Intergenic
912755540 1:112321769-112321791 CAGAGGGAGTGGAGAGAGGATGG - Intergenic
912865467 1:113252410-113252432 AAGTGGTAATGGAGATAAGTGGG + Intergenic
913163873 1:116168110-116168132 CAGTGGGCGGGGAGAGAAGAAGG + Intergenic
913311549 1:117501307-117501329 CAGTGGAAGTGATGAGAAGAGGG + Intronic
913539209 1:119802922-119802944 CTGGTGAAATGGAGAGAAGAGGG - Intronic
914199579 1:145472936-145472958 CAGTTGCTATGGAGATCAGATGG + Intergenic
914445649 1:147748631-147748653 CAGTGGAAATGCTCAGAAGAAGG + Intergenic
914478694 1:148046069-148046091 CAGTTGCTATGGAGATCAGATGG + Intergenic
914815220 1:151058147-151058169 AAGGGGCAGTGGAGAGAACAAGG + Exonic
916185439 1:162127679-162127701 CAGAAGCAATAGAGAGACGAAGG + Intronic
916520327 1:165557837-165557859 CAGTGGCAATGGAAAGCAAGAGG - Intronic
917161928 1:172067336-172067358 CAATGGAAATGGAGAAAAGTGGG - Intronic
917537236 1:175883306-175883328 CAGAGGGAAAGAAGAGAAGAGGG - Intergenic
918743527 1:188168314-188168336 GAGTGGAAAAGTAGAGAAGAAGG + Intergenic
919293327 1:195661989-195662011 CAGTAGCAATGTAGACAATATGG + Intergenic
919493467 1:198234846-198234868 CAGTGTGAATGCAGAGAGGAGGG - Intronic
920288814 1:204901856-204901878 CCGCGGTAATGGAGAGAAGGTGG + Intronic
920730743 1:208481728-208481750 CAGTGACAGTGGGGAGAAGAAGG - Intergenic
920877152 1:209847367-209847389 GAGTGGGGATAGAGAGAAGATGG - Intronic
921513479 1:216061141-216061163 CAGTTGCAATGGAGAGTCCAAGG - Intronic
922247359 1:223813540-223813562 CAGTGGGACAGGGGAGAAGAGGG - Intronic
922426490 1:225501021-225501043 CAGTGCCAATGGAGTCCAGACGG - Exonic
922429748 1:225539214-225539236 CAGTAGCAATGGAGAGAGTTTGG - Intronic
922468838 1:225862852-225862874 CTGTGGCCAGGGAGAGAAGGAGG + Intronic
923275898 1:232396062-232396084 CAGTGAAAGTGGAGAGAAGTAGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923429433 1:233905796-233905818 CTGTGACAATGGTAAGAAGATGG - Intronic
923560417 1:235035979-235036001 CAAGGGCAATGGAAAGAAAATGG - Intergenic
923994050 1:239471632-239471654 CAGTGGGAGAGGAGAGAAGGGGG - Intronic
924460548 1:244254858-244254880 CAGAGAGAATGGAGAGAAGGAGG - Intergenic
1062788411 10:284592-284614 GAGTGGCAAGGGGGAGATGACGG + Intronic
1063057048 10:2517037-2517059 CAGGGACAATGGAAAGAAGGAGG - Intergenic
1063121188 10:3106599-3106621 CAGTGGCAGGGGTGAGGAGAGGG - Intronic
1063663546 10:8049276-8049298 CACTGGCAATGGGAAGATGATGG - Intergenic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1063869593 10:10403293-10403315 CAGGAGGAATGGAAAGAAGAGGG + Intergenic
1064453695 10:15467215-15467237 GTGTGGCAGGGGAGAGAAGAGGG + Intergenic
1064499639 10:15956421-15956443 AAGAGGCAATGGGGAGATGAAGG - Intergenic
1064514833 10:16135749-16135771 GAGTAGAAATGGAGAGTAGAGGG + Intergenic
1065069570 10:22008636-22008658 CATTGGCAATGAGGAGAGGAGGG + Intergenic
1065100619 10:22327739-22327761 CAGATGAAATGAAGAGAAGAAGG + Exonic
1065967506 10:30781611-30781633 CAGTGGCAATGGGGACCAGTGGG - Intergenic
1066067378 10:31772198-31772220 CAGTGCCAAGGGAGAGCAGGAGG + Intergenic
1067268349 10:44767133-44767155 CTGTGGCTTTGGAGATAAGAGGG + Intergenic
1068764678 10:60750007-60750029 CAGTGGCTAAGGAGAGTAGGAGG + Intergenic
1069583951 10:69584575-69584597 CAATGGGAATGGAGTGAAGTGGG + Intergenic
1069938636 10:71937710-71937732 TAGTTGAAATGGAGAGAAGTGGG - Intergenic
1070183158 10:74033927-74033949 CAGTGTGAATGGAGATGAGAGGG - Intronic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1071460618 10:85890759-85890781 AAGGAGCAAGGGAGAGAAGAAGG + Intronic
1071468703 10:85963303-85963325 TAGTGGCAGTGGAGAAAGGAAGG - Intronic
1071490058 10:86130224-86130246 CAGTCCCCTTGGAGAGAAGAAGG - Intronic
1071870851 10:89792872-89792894 CAGTTTTAATGAAGAGAAGATGG + Intergenic
1071952837 10:90724397-90724419 GGGTGCCAAAGGAGAGAAGAAGG + Intergenic
1072009588 10:91291571-91291593 CAGAGGCATGGGACAGAAGAAGG - Intergenic
1072310320 10:94148211-94148233 AAGTGGAGATGGAGCGAAGAAGG + Intronic
1072832352 10:98672202-98672224 AAGTGGCAAGGAAGAGAAAAAGG + Intronic
1072855002 10:98937091-98937113 CTGTGACAATGGAGCCAAGATGG + Intronic
1073586025 10:104710915-104710937 CAGTGGCATTTGTGAGTAGATGG + Intronic
1074300904 10:112232577-112232599 CAGAGGGAATGGAGATAAGTAGG + Intergenic
1075199664 10:120392063-120392085 TACTGGCTATGGACAGAAGAGGG + Intergenic
1075951418 10:126481006-126481028 CAGTGGGACTGCAGAGCAGAGGG - Intronic
1076234963 10:128856337-128856359 CAGTGGCCATGGACAGAGGAAGG - Intergenic
1076695309 10:132244477-132244499 CAGGGGCAATGGGGAGATGCTGG + Intronic
1077048986 11:558311-558333 CAGTGGCGAAGGAGGGGAGAAGG + Intronic
1077553309 11:3213786-3213808 CAGCAGCAATGCAGGGAAGAGGG - Intergenic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1078441563 11:11372633-11372655 CAGGGGCAGGGGAGAGCAGAAGG + Intronic
1078493829 11:11796310-11796332 CAGGTGGAATGGAGAGGAGAGGG - Intergenic
1079133446 11:17762811-17762833 GGGTGGGAATGGAGAGACGAAGG - Intronic
1080269846 11:30439626-30439648 AAGTGGCAGTGGAGACAAAAGGG + Intronic
1080461931 11:32462301-32462323 GAGGGGAACTGGAGAGAAGAGGG - Intergenic
1080582275 11:33653682-33653704 AAGTCCCAAAGGAGAGAAGAAGG - Intronic
1080858758 11:36135000-36135022 CAGGGAAAATGGAGAAAAGAAGG - Intronic
1081194089 11:40140038-40140060 CAGGGACAAGGGAGAGAAGAAGG + Intronic
1081284334 11:41248988-41249010 CAGTGGCTATAGTGAGAAGTGGG - Intronic
1081803502 11:45876076-45876098 CAGAGGAAATGGAGGAAAGAGGG - Intronic
1082704812 11:56480312-56480334 CAGTGGCTATGTAGACAAAAAGG + Intergenic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1083487016 11:62989651-62989673 AAGCAGCAATGGAGAGAAGGAGG + Intronic
1083902834 11:65652037-65652059 CAGTGACAGTGGGGAGAAGTGGG + Intergenic
1084756192 11:71240374-71240396 GAGGGGCTAGGGAGAGAAGATGG - Intronic
1084927460 11:72524924-72524946 AAGTGGCCATGGAAAGATGAAGG + Intergenic
1085331850 11:75658702-75658724 GAATGGCAAGGGACAGAAGAGGG - Intronic
1085610434 11:77943381-77943403 CAGTGGAAATGGAGAAGGGATGG + Intronic
1085930520 11:81077219-81077241 CAGTGGGAAGACAGAGAAGAAGG - Intergenic
1086340535 11:85844018-85844040 CAGGGGCATTCGATAGAAGAAGG + Intergenic
1086849024 11:91786569-91786591 CAGTGGTAATGCAGGGCAGATGG - Intergenic
1087177605 11:95109756-95109778 CAGTGGTGATGGGGAGGAGAAGG - Intronic
1087569064 11:99901188-99901210 TATTGACAATGGAGACAAGATGG - Intronic
1087681693 11:101225070-101225092 CAGTGGCACTGGAGAGTGGCGGG + Intergenic
1087795302 11:102450132-102450154 GAGTGGCAATGGAGATAAAAGGG - Intronic
1087955564 11:104282785-104282807 CAGGGGTAATGGAGGGAATAAGG - Intergenic
1088109340 11:106244491-106244513 CATTGGGACTGGACAGAAGAAGG + Intergenic
1088489667 11:110374568-110374590 AAGTTGCAAAGGTGAGAAGAGGG + Intergenic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1088884156 11:113994154-113994176 CAGAGGCAAAGGAGGGAAGGTGG - Intergenic
1089873926 11:121701766-121701788 CAGCGGCAATGGAGATGAAAAGG + Intergenic
1090414478 11:126531197-126531219 CAGTGGGAATAGAGAGGAAAGGG - Intronic
1090443181 11:126741180-126741202 AAGTGGAAATGGAGAACAGAAGG - Intronic
1090815492 11:130290494-130290516 CAGTGGCAGTGGAGAAAGGAAGG - Intronic
1090924203 11:131235431-131235453 CAGTGGCAGTGGAAAGCACACGG - Intergenic
1090937257 11:131354169-131354191 CAGTGTTACGGGAGAGAAGAGGG - Intergenic
1091041409 11:132284763-132284785 CAGTGGCCTTGGGGAGAAGGCGG + Intronic
1091062318 11:132474965-132474987 TAATGGTAATGGAGAGAACATGG - Intronic
1091528180 12:1327555-1327577 CAGTTGTAAGGGAGAGAAAAAGG - Intronic
1091626690 12:2126584-2126606 AAGTGGAGGTGGAGAGAAGACGG + Intronic
1091965620 12:4738829-4738851 CTGTGGCAATGACAAGAAGAAGG + Intronic
1092352870 12:7770058-7770080 AAGCAGAAATGGAGAGAAGAAGG + Exonic
1093791685 12:23258641-23258663 AAGAGGCAATAGAGAAAAGAAGG + Intergenic
1094025354 12:25956087-25956109 CAGTGGCAATGAACAGGAGGAGG - Intergenic
1094272970 12:28637729-28637751 GAATTGCAATGGAGAGCAGAGGG + Intergenic
1096253366 12:50047835-50047857 CAGTGGCAATGGAAATAAAAAGG - Intergenic
1096586531 12:52625999-52626021 CAGTGTCACAGGAGAGAAGTGGG + Intergenic
1097228181 12:57491520-57491542 CAGTGACAACAGAGAGGAGAAGG - Intronic
1097788961 12:63793672-63793694 TAGTAGAAATGGAGAGAAGTGGG + Intronic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098469398 12:70826309-70826331 TAGTGGGAAAGGTGAGAAGAGGG + Intronic
1099458463 12:82893942-82893964 CAGAGGAGATGGAGAGAAAAAGG + Intronic
1099610273 12:84858558-84858580 CACTGGCAAAGAAGAGAAAATGG + Intergenic
1099614286 12:84914477-84914499 CAATGCCAATGAAGAGAAGTAGG + Intergenic
1099980093 12:89589338-89589360 CAGAGGCAAAAAAGAGAAGAAGG + Exonic
1100497283 12:95137810-95137832 CAGTGGAAATGGTGAAAAGTAGG - Intronic
1100631276 12:96391737-96391759 TAGTGAAAATGGAGAGAAAAGGG - Intronic
1101898338 12:108772170-108772192 AAGTGGGCAGGGAGAGAAGAGGG + Intergenic
1102676531 12:114663276-114663298 TGGTGGCAGTGGAGAGGAGAGGG + Intergenic
1103198982 12:119070909-119070931 CAGAGGCAGTGGAGTAAAGACGG - Intronic
1104666828 12:130653555-130653577 CAGTGGAGTTGGTGAGAAGAGGG - Intronic
1105016444 12:132788720-132788742 CCATGGCAATGGGGAGAAGCTGG + Intronic
1105469194 13:20676499-20676521 CACTGGCAGTGGTGAGAACATGG - Intronic
1106587740 13:31072012-31072034 CAGCGGTGCTGGAGAGAAGAGGG - Intergenic
1108148148 13:47501327-47501349 CAGTGGCAGTGGGGAGAAATGGG - Intergenic
1109035951 13:57260476-57260498 CAGTTGCTATGGAGATCAGATGG - Intergenic
1109144967 13:58768219-58768241 CAGTGGCTAGGGGGAGAAGGAGG - Intergenic
1110009274 13:70311386-70311408 GAGTGTCAATGGAGAGAAGTTGG - Intergenic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1110783736 13:79497983-79498005 TAGTGGCACTGAAGAGAAGTGGG + Intronic
1110884831 13:80619624-80619646 CTGAGGCAATGGCAAGAAGAGGG - Intergenic
1111280282 13:86014153-86014175 CAGTAGCAATGGAAAGATGGAGG + Intergenic
1111489761 13:88956514-88956536 CATTGGAAATGGAAAGAAGATGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1113599300 13:111557437-111557459 GAGTGGTGATGGAGAGAAAATGG + Intergenic
1114808155 14:25862126-25862148 CATTGGAAGTGGAGGGAAGATGG + Intergenic
1114815204 14:25949290-25949312 CAGTGGTAATAGAGAGATGAAGG - Intergenic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1115088997 14:29551375-29551397 CAGTCACAATGGAGATAACAGGG - Intergenic
1115146442 14:30231835-30231857 CAGTGGAAATCTAGAGAGGAGGG - Intergenic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1116283719 14:42945354-42945376 AATTGGAAATGGAGATAAGATGG + Intergenic
1116494080 14:45539413-45539435 CAGTGGCTAGGAAGAGTAGAGGG - Intergenic
1116507184 14:45698588-45698610 CAGAAGCAAGAGAGAGAAGAGGG - Intergenic
1117612229 14:57496247-57496269 CAGAGGAGATGGAGAGAAGCAGG + Intergenic
1117871842 14:60209361-60209383 CAGGAGCCATGTAGAGAAGATGG - Intergenic
1118139012 14:63059385-63059407 CAGTGGAAACAGATAGAAGATGG + Intronic
1118151773 14:63197257-63197279 CAGTAGCCATGGACAGAAGTAGG - Intergenic
1118151976 14:63199520-63199542 CAGTAGCCATGGACAGAAGGTGG - Intergenic
1118572493 14:67207571-67207593 CAGGGGCAGTGGAAAGAAGAAGG + Intronic
1119469250 14:74883466-74883488 GAGTGGCAAGAGATAGAAGATGG + Intronic
1120147292 14:80992445-80992467 CAATGAAAATGGAAAGAAGAAGG - Intronic
1120522033 14:85534730-85534752 CGGCGGCAGCGGAGAGAAGACGG + Intronic
1120572535 14:86139272-86139294 GAGTGGCAATGAAGAGAGGTTGG + Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121822757 14:96984617-96984639 CCATGGTAATGGAGAGAAGACGG + Intergenic
1121963342 14:98281664-98281686 CAGTGAAAATGCTGAGAAGATGG + Intergenic
1124292153 15:28463139-28463161 CAGTGGAAAAGGAGAGAACTTGG + Intergenic
1125083626 15:35704463-35704485 CAGAGTCAATGCAGAGTAGAAGG + Intergenic
1125472996 15:40022710-40022732 CAATGGAAAGGGAGAGTAGAGGG - Intronic
1125609031 15:40958498-40958520 CAGTGGGAATGGACAGTGGAGGG + Intergenic
1125767256 15:42144047-42144069 CAGTGGGAACGGAGAGTTGATGG + Exonic
1126287690 15:47032919-47032941 CAGTGAGAATGTAGAGAAAAGGG - Intergenic
1126522145 15:49606831-49606853 CAAGGGAAATGAAGAGAAGAAGG + Intronic
1126710632 15:51451916-51451938 GAGTGGCAATGGAAAGGAGATGG - Intronic
1127471493 15:59294618-59294640 CAGGGGCAAGGGAGCCAAGAAGG - Intronic
1127597526 15:60501306-60501328 CAGTGGCAATGGTGATGTGATGG - Intronic
1128037887 15:64542750-64542772 AAGTGGGGATGGAGAGAAGGAGG - Intronic
1128637590 15:69313186-69313208 CATTGCCAATGCAGAGAATAAGG + Intronic
1128709425 15:69860630-69860652 CAGTGTCATGGGAGAGAACATGG + Intergenic
1129693801 15:77729176-77729198 CAGTGCCAGTGGGGAGATGATGG + Intronic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130303953 15:82700355-82700377 CAGTGGCATTGGAGACCAGTGGG - Intronic
1130352674 15:83106149-83106171 TAGAGGCAGTGGAGAGATGAGGG - Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131515862 15:93076257-93076279 GAGTGGAAAGGGAGAGAAGGTGG - Intronic
1132413054 15:101600083-101600105 CAGTGTCAATGGAGGCCAGAAGG - Intergenic
1132435720 15:101800210-101800232 GAGTGGGGATGGAGAGAACAGGG + Intergenic
1132730461 16:1358505-1358527 CAGTGTCCATGGACAGATGACGG - Intronic
1132846184 16:2001914-2001936 CAGTGGGAAGGGAGAGGAGGAGG + Intronic
1133597325 16:7305052-7305074 CACTGGCAATGCTGTGAAGAAGG + Intronic
1134444539 16:14320842-14320864 GACTGGCAAAGGAGAGGAGAGGG + Intergenic
1135459398 16:22628383-22628405 CAGGGGAAAGGGAGAGACGATGG - Intergenic
1135943175 16:26840566-26840588 AAGGGGGAAGGGAGAGAAGATGG + Intergenic
1136409719 16:30069232-30069254 CAGTGGCTGTGGAGAGATGTAGG + Intronic
1137637821 16:50002428-50002450 CAGTTGGAAGGGAGAGAACAGGG + Intergenic
1139261166 16:65595676-65595698 CAGGGCCAAAGGAGAGCAGAGGG - Intergenic
1139482786 16:67239921-67239943 GAAGGGGAATGGAGAGAAGATGG + Intronic
1139588218 16:67917887-67917909 CAGAGGCACTGGAGTGGAGAGGG + Intronic
1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG + Intronic
1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG + Intergenic
1140891549 16:79289374-79289396 GAGTGGCAGTGGGGAGAAGATGG + Intergenic
1141118233 16:81330092-81330114 CAGTGGCAATGGTGAAGAGAAGG - Intronic
1141494137 16:84395274-84395296 CAGTGACACTGGAGGGGAGAGGG - Intronic
1141571126 16:84934228-84934250 CCCTGGCAATGGAGAGAGGGAGG - Intergenic
1141621313 16:85238042-85238064 TAGGGGCAGTGGAGAGAGGAGGG + Intergenic
1142951206 17:3481964-3481986 CAGAGGCAGTGGTGAGAGGAAGG + Intronic
1144051617 17:11501857-11501879 TAGTGGAAAAGGAGAGAAAAGGG + Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144066313 17:11627717-11627739 AAGTGGGAGGGGAGAGAAGAGGG - Intronic
1144511590 17:15881782-15881804 TAGGGGCTACGGAGAGAAGAAGG - Intergenic
1144564309 17:16347340-16347362 CAGTGGCTATGGAGTGAGCAAGG - Intronic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1146685781 17:34840792-34840814 AAATGGCAATAGAGAGTAGAAGG + Intergenic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1147426511 17:40348299-40348321 CAATGGCTAGAGAGAGAAGAGGG - Exonic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1147568392 17:41551773-41551795 CAGTGGCAATGAAGGAACGAGGG - Intergenic
1147685936 17:42286991-42287013 GAGTGGGAAAGGAGAGGAGAGGG + Intergenic
1147685980 17:42287265-42287287 GAGTGGAAATGGAGAGAAAAGGG + Intergenic
1148528546 17:48366432-48366454 CAGTAGCAAAGGGGAGAGGAAGG + Intronic
1148856593 17:50582350-50582372 CCCTGGAAATGGAGAGCAGAGGG + Intronic
1148868904 17:50643977-50643999 CAGGGGCACTGGAGGGCAGAGGG + Intronic
1149061928 17:52432914-52432936 CAGTGACTTTGGAGAGAACAGGG + Intergenic
1149495621 17:57115600-57115622 CAGAGGCAAAGGCTAGAAGAAGG + Intronic
1150712582 17:67544419-67544441 GAGGGGCACTGGAGAAAAGATGG + Intronic
1150803640 17:68301743-68301765 CAGAAGCAATGGAGAAAGGAAGG - Intronic
1151018192 17:70581512-70581534 CAGGGGCAAGGGAGAGAGGGAGG - Intergenic
1151246169 17:72796555-72796577 GAGTGGCAAAGGAGAACAGAGGG + Intronic
1151751982 17:76044438-76044460 AAGGGGCCATGGAGTGAAGACGG + Intronic
1152154794 17:78625927-78625949 CAGTGGCCATGCAGAGAAGCAGG + Intergenic
1152285445 17:79410053-79410075 GAGTGGCAGTGGAGAGGAGCAGG - Intronic
1153397631 18:4642436-4642458 CATGGGCAAAGGTGAGAAGAAGG - Intergenic
1153820895 18:8830474-8830496 CAGTGTCACTCGGGAGAAGATGG - Intronic
1153864397 18:9250397-9250419 TAGTGGGAATAGAGAGAAAACGG + Intronic
1154145358 18:11862136-11862158 CTGTGGCAGTGGAGAAGAGAGGG + Intronic
1154336667 18:13471431-13471453 CTTTCGTAATGGAGAGAAGAGGG + Intronic
1155576040 18:27248047-27248069 CAGTGGAAGTGGGGAGAAGTGGG - Intergenic
1155627100 18:27846905-27846927 CAGTGGTGATGGACAGAAGTGGG - Intergenic
1156134542 18:34021707-34021729 CAGTGGCAATGCAGAAAAAGAGG + Intronic
1156660877 18:39345118-39345140 GAGAGGAAAGGGAGAGAAGAGGG + Intergenic
1157009773 18:43633193-43633215 CAGTAAAAATGGAGAGAAAAGGG - Intergenic
1157024992 18:43831842-43831864 CAGTGGAGAGGGAGAGAAGGGGG - Intergenic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157557940 18:48624990-48625012 CAGTGGCAATGAATAGGATAGGG + Intronic
1157804432 18:50647708-50647730 CTGTGGCAAAGGACAGAAAATGG - Intronic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1158086853 18:53661650-53661672 CCCTGGCAATGGAGAGAACATGG - Intergenic
1158411795 18:57212051-57212073 CAGAGGGAATGAAGAAAAGAAGG + Intergenic
1159024253 18:63168170-63168192 CATTGGCAATGGATGGAACAAGG - Intronic
1160336035 18:78040526-78040548 CAGTAGTAATGGAGAGATCATGG - Intergenic
1160397774 18:78584527-78584549 CAGAGGCCATGGCGAGCAGACGG + Intergenic
1160425764 18:78778132-78778154 CAGTGGCCACTCAGAGAAGATGG + Intergenic
1163202689 19:15779974-15779996 CAGGGACAGTGGAGAGAAGCAGG + Intergenic
1163842539 19:19620033-19620055 CAGCAGCAATGGAGAGAACGTGG - Intergenic
1167030980 19:46960184-46960206 CAGGGCTAATGGAGAGAAGGCGG - Intronic
1167324087 19:48813343-48813365 CAGTGGCTGGGGAGAAAAGAGGG + Exonic
1167399485 19:49255468-49255490 CAGTGTCACTGGTGAGGAGAGGG - Intergenic
1167466800 19:49654464-49654486 CCGAGGCAATGGACAAAAGAAGG - Intronic
1167787840 19:51650363-51650385 CAGTGGAAGTGGTGAGAAGAGGG + Intergenic
1168138924 19:54371769-54371791 CAGTGGAAATGGAGAAACGCAGG - Intergenic
1168159010 19:54496094-54496116 CAGTGGAAATGGAGAAACGCAGG + Intergenic
1168588434 19:57613707-57613729 CAGTGGCTATGGAGGGATGCTGG - Intergenic
924970329 2:120687-120709 CACTGGCCAAGGAGAAAAGATGG - Intergenic
925412320 2:3647067-3647089 CAGAGGCAATGGGGGGATGAGGG - Intergenic
925427128 2:3759119-3759141 CAGGGGCAATTCAGAGATGAGGG + Intronic
925731998 2:6925755-6925777 CAGATGCAATCAAGAGAAGATGG - Intronic
925814260 2:7732369-7732391 AAGTGGGAATGGAGAGGAGCAGG - Intergenic
927476345 2:23417108-23417130 CAGAGGCAATGAAGAGAAGAAGG - Intronic
927783090 2:25954890-25954912 CAGTGGCTTTGGAGAGGAGCAGG - Intronic
927894380 2:26772009-26772031 CAGGGGCAAAGGAGAGTTGAAGG - Intronic
928814007 2:35267545-35267567 CAGGGGAAAGGGAGAGAAGTTGG - Intergenic
928866472 2:35922804-35922826 TAGTGGAAAGGAAGAGAAGAAGG + Intergenic
929371701 2:41232747-41232769 GAATGGCAAGGGAGAGTAGATGG + Intergenic
930151508 2:48064850-48064872 CATTGGCAATGGAAAGAAAATGG - Intergenic
930192413 2:48473680-48473702 AAGTTGCAATGGAGAGAGAATGG + Intronic
931050436 2:58407671-58407693 CAGTGGCAATGGAGATGGGATGG - Intergenic
931287605 2:60845830-60845852 CTGTGCCAATGGAGTGGAGAGGG - Intergenic
931877375 2:66528626-66528648 CAGTGGCAATGGAGCTAGGTGGG - Intronic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932580590 2:72990502-72990524 CAGTAGCAATGAAGAGGAGGGGG + Intronic
932791517 2:74657873-74657895 CATTGGCAATGGCGAGAATCTGG - Exonic
933158702 2:79001390-79001412 CAATAGGAATGAAGAGAAGAGGG - Intergenic
933271061 2:80233443-80233465 CAGCTGCAATTGAGATAAGATGG - Intronic
933758259 2:85657546-85657568 CAGAGGCTGTGGGGAGAAGATGG + Intronic
933820193 2:86104253-86104275 CAGTAGCAATTGGGAGAAAAAGG + Intronic
935482139 2:103603482-103603504 CAGTGGGAATGGAGAGAGTGAGG + Intergenic
935691983 2:105740397-105740419 CAGGGGAACTGGAGAGCAGAAGG + Intergenic
936060619 2:109293476-109293498 CACTGGCAGTGGAGAGAGAAGGG - Intronic
936356661 2:111757737-111757759 CACTGGCAATGCGGAGAAAATGG + Intergenic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
937220884 2:120342838-120342860 CTGTGGAAAGGGAGAGAATATGG - Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
938270262 2:129964024-129964046 CATTGGGAATGGGGAGAAAAAGG - Intergenic
939417373 2:141916767-141916789 GAGTGGGAAGGGAGAGAGGACGG + Intronic
939482561 2:142767709-142767731 CAGAGGCAATGAAGAGAGGCTGG + Intergenic
939792242 2:146592340-146592362 CAGTGGCAAGAGAAATAAGATGG - Intergenic
940929793 2:159414284-159414306 GAGGGGCAAGGGAGTGAAGATGG + Intronic
940976876 2:159956259-159956281 CAGTAGCAGTGGAAAGAATAAGG - Intronic
942840946 2:180360061-180360083 CACAGGAAATGGAGAGAAGCAGG + Intergenic
943176776 2:184486011-184486033 CACTGGCATTGGAGTGAAGAAGG + Intergenic
943458109 2:188133045-188133067 CAGTGGAACTGGGAAGAAGATGG + Intergenic
944101603 2:196033439-196033461 CAGGGGGAATGGGGAGATGATGG - Intronic
945519966 2:210814211-210814233 CAGGAGCAATGGAGAGAAGTAGG + Intergenic
945599276 2:211838322-211838344 CAGAGGCTATGTAGAGATGATGG - Intronic
945743717 2:213694791-213694813 GAGAGGCAAGGGAGAGTAGAAGG - Intronic
946272232 2:218603930-218603952 CAGTGGCAATGGCGTGAACTTGG + Intergenic
946489394 2:220133098-220133120 CAGTAGCAATGGAATGGAGAAGG - Intergenic
946535003 2:220617972-220617994 CAGAGGCAATACACAGAAGAGGG - Intergenic
947289549 2:228557207-228557229 TGGTGGAAATGGAAAGAAGAGGG - Intergenic
947359029 2:229328392-229328414 CAGTGGCACTGGTGTGAGGATGG + Intergenic
947915648 2:233830351-233830373 CAGAGACTAGGGAGAGAAGAGGG - Intronic
948100408 2:235368446-235368468 CAGTAGCAAAGGAGACAAGTTGG + Intergenic
948192199 2:236068380-236068402 CAGTGCCAGAGGAGAGGAGAGGG - Intronic
1168792708 20:590622-590644 CAGTGTGATTGGAGAGAGGATGG + Intergenic
1168844450 20:934377-934399 CAGGGTCCAGGGAGAGAAGAGGG - Intergenic
1169487994 20:6049451-6049473 CAGTGGCAATGGTGATGTGATGG - Intronic
1169688108 20:8299827-8299849 AAGTGAAAATGGAGAGAAGTGGG - Intronic
1170687689 20:18584345-18584367 CAGGAGGGATGGAGAGAAGAGGG + Intronic
1171002310 20:21426815-21426837 CAGTGGAGAGGGAGAGCAGAAGG - Intergenic
1172442832 20:34977981-34978003 CAGTGGCACTGGGGTGAAGGAGG - Exonic
1172697122 20:36830619-36830641 CAGTGGAAACCCAGAGAAGATGG + Intronic
1172789598 20:37493702-37493724 CAGTGCAGATGGAGAGAAGGCGG - Intronic
1172928683 20:38565390-38565412 CATTTTCAATGGACAGAAGAAGG + Exonic
1173230945 20:41197073-41197095 CAGGGCTGATGGAGAGAAGAAGG + Intronic
1174251108 20:49220312-49220334 CAGTGTGAATGGAGAGAGGCGGG - Intronic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175340266 20:58224526-58224548 CAGTGGCCCTGGAGGGAAGCAGG - Intronic
1176668977 21:9714315-9714337 TATTGCCAATGGAGACAAGAGGG - Intergenic
1177295410 21:19166966-19166988 ATGTGGCAATGAAGAGAAGATGG + Intergenic
1177722930 21:24930180-24930202 AAGTGGAGATGGAGAGAAGGGGG - Intergenic
1178753893 21:35329281-35329303 CATTGGAAATGGCAAGAAGATGG - Intronic
1179114196 21:38475220-38475242 CAGTGGCAAGGGATGGGAGATGG + Intronic
1179370770 21:40804394-40804416 CAATGGCAATGGAAAGAACAAGG - Intronic
1179731219 21:43368317-43368339 CAGTGACAACGGGGACAAGAGGG + Intergenic
1179992960 21:44958201-44958223 CAGTGGCTATGGGGAGGGGAAGG - Intronic
1180662041 22:17476134-17476156 GAGTGACAATGGAGAGAGGCAGG - Intronic
1181508021 22:23374808-23374830 CAGTGGTCATGGATAGAGGAGGG - Intergenic
1182144698 22:27990296-27990318 GAGAGGCCATGGAGAGTAGAAGG + Intronic
1182789404 22:32937155-32937177 ACGTGGAAATGGAGAGATGATGG + Intronic
1182868384 22:33624868-33624890 CAGTGGGGATGGAGAGAACGGGG + Intronic
1182979027 22:34650732-34650754 CAGGAGCAAGGCAGAGAAGAGGG + Intergenic
1183307497 22:37090392-37090414 CACAGGCAATGAGGAGAAGAAGG + Intronic
1183875242 22:40774939-40774961 TGGTGGCACTGGAGAGGAGAGGG - Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184262804 22:43329090-43329112 CACTGGCATGGGAGGGAAGAAGG - Intronic
949203020 3:1403358-1403380 CAATGACAATGGAAAGAAAATGG - Exonic
950021820 3:9792832-9792854 CTGTGGCAAAGGTGACAAGAAGG + Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
951693947 3:25426698-25426720 CAGAGGCAGTGGAGAAAAAAGGG + Intronic
951991390 3:28679340-28679362 CAGGAGGAATGGGGAGAAGAGGG - Intergenic
952052000 3:29395183-29395205 GACTAGCAATGGAGAGGAGAGGG - Intronic
953403149 3:42644538-42644560 CAGTTGCAATGGACAGGGGAAGG - Intronic
953421965 3:42761224-42761246 CAGTGGGAATGGAGACATGGGGG - Intronic
954215945 3:49124549-49124571 CAGTGGCACTGGTCAGGAGATGG + Exonic
954573548 3:51662372-51662394 GAGTGGCCAGGGAGAGAAGAAGG - Intronic
954677603 3:52324404-52324426 CAGTGGCAGAGGGGAGAACAGGG + Intronic
954710002 3:52500955-52500977 CAGTGGGAATGCAGTGCAGATGG - Intronic
954722761 3:52579775-52579797 CAGTGGGAATTGAGAGCAGGAGG - Intronic
955907844 3:63826367-63826389 CAGTGGGAATGGGGAGATAAAGG + Intronic
956176661 3:66479218-66479240 CAGAGGAAATGCAGAGAAAACGG + Intronic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956471625 3:69573150-69573172 CAGTGAAGATAGAGAGAAGAGGG + Intergenic
957856032 3:85879995-85880017 CAGGGGCGATGGAGAGTAGAGGG - Intronic
958728299 3:97932838-97932860 CAGTGGATCTGGAAAGAAGATGG - Intronic
959420195 3:106119012-106119034 CAGTGTCAATGGAGAACACATGG - Intergenic
960036069 3:113104443-113104465 TACTGGCAATGGAGAGATGGGGG + Intergenic
960231674 3:115235273-115235295 CAGTGGCCAAGGAGAGAAAGGGG + Intergenic
960268685 3:115650541-115650563 AAGTGGGAATGGGGAGAAGGAGG - Intronic
960296623 3:115952562-115952584 CAGGGGGAATGGTGAGAGGAGGG + Intronic
960537036 3:118826034-118826056 TGGTGGAAATGGAGAGAAGGAGG + Intergenic
960727872 3:120689245-120689267 CATTTGCAAAGGAGAGAAGAGGG + Exonic
961632328 3:128310280-128310302 CAGAGGGAAAGGAGAGAAAAAGG - Intronic
962024234 3:131530115-131530137 CAGTGTCAATATAGAGAAAAAGG - Intergenic
962166590 3:133055660-133055682 CAGTGGGCATGGAAAGAAAAAGG - Intronic
962271108 3:133978701-133978723 GAGTGGCCCTGGGGAGAAGATGG + Intronic
962282339 3:134061353-134061375 CATTGGCAGAAGAGAGAAGAAGG - Intergenic
962455764 3:135564119-135564141 CAGTCTCACTGGAGAGATGAGGG + Intergenic
962760565 3:138509342-138509364 CAGTGGCAAAGAACAGAAAATGG + Intronic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
963513807 3:146282330-146282352 AAGTGGGAATTGATAGAAGAAGG + Intergenic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
966431257 3:179833172-179833194 CAGTGGGAATGGAGAGGAAAGGG + Intronic
966462816 3:180196488-180196510 TAATGGCAATGGTGGGAAGAGGG - Intergenic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967180182 3:186896664-186896686 AAGTGGCAATGGTGAGAAATGGG - Intergenic
967553913 3:190832029-190832051 CAGTGGCAATGGAGTCCAGATGG + Intergenic
968743379 4:2342839-2342861 CAATGGGAAAGGAGAGAAGTGGG + Intronic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969418219 4:7074814-7074836 CAGGGGCAAGGGAGAGAGGTGGG - Intergenic
970105318 4:12575992-12576014 TAGTGGAAAAGGAGAGAAAAGGG + Intergenic
970912387 4:21292410-21292432 CGGTGGCAAATGAGAGAATAGGG - Intronic
971044036 4:22784888-22784910 CAGTGGCAATGAAGAAGAGGAGG - Intergenic
971828166 4:31654890-31654912 GAGTGTCAAAGGAGAGAAGGTGG + Intergenic
971864680 4:32154289-32154311 AAGGAGCAAGGGAGAGAAGAAGG - Intergenic
972165632 4:36280790-36280812 CAGTGGGATTGGAGAGAGGGAGG + Intergenic
973015396 4:45131063-45131085 AAGTGGCAATGAAGGGAAGCTGG - Intergenic
973922678 4:55704767-55704789 AAGTGGCAAAGGGGAGAATAAGG - Intergenic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974384793 4:61190302-61190324 CATTGGCAAGAGAGAGAAGTGGG + Intergenic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
974831257 4:67192431-67192453 CAGTAGAAATGGAGAGATAAAGG - Intergenic
975282587 4:72578769-72578791 CAAGGGCAATGGAGAGAGCAGGG + Intergenic
975798609 4:78035322-78035344 CAGTGGCAATGAAAAGATGTTGG + Intergenic
975823332 4:78293761-78293783 CAGAAAAAATGGAGAGAAGAGGG + Intronic
975938131 4:79606814-79606836 AAGTAGCACTGCAGAGAAGATGG - Intergenic
976291227 4:83420330-83420352 CAGTGGCAATCAAGAGAATATGG + Intronic
976708956 4:88048586-88048608 CAGTGGCAGAGTAGTGAAGAGGG - Intronic
977601617 4:98939404-98939426 CAGTGAGAATGAAGAGGAGAGGG - Intergenic
977822210 4:101486269-101486291 CAGGGGCTATGGAGAGGAGAGGG - Intronic
977969887 4:103200950-103200972 TTGTGGCAATGGAGAGAGGTAGG + Intergenic
978119326 4:105059592-105059614 GGGTGGGAATGGGGAGAAGAGGG + Intergenic
978421856 4:108541787-108541809 CAGGAGCAAGGGAGAGAAGGGGG - Intergenic
978564252 4:110065125-110065147 CAGTGGCACTGAAGAGCTGAAGG + Intronic
978671527 4:111252944-111252966 CATGCACAATGGAGAGAAGAGGG + Intergenic
979683793 4:123489087-123489109 CAGAGGCAAGGGAGAAATGAAGG - Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980091689 4:128449481-128449503 AAGAGGAAATGTAGAGAAGAGGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
981695058 4:147551516-147551538 CAGGGGCAAGGGAGAGACGTGGG + Intergenic
981730021 4:147887329-147887351 CTGGAGCAGTGGAGAGAAGATGG - Intronic
982104123 4:151997100-151997122 CATTGGGAATGGAAAGAGGAAGG + Intergenic
983215741 4:165000819-165000841 CCTTGGGAATGGGGAGAAGAAGG + Intergenic
983336100 4:166394549-166394571 GAGGGGGAAGGGAGAGAAGAGGG + Intergenic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984646273 4:182223948-182223970 CAGAGGCAATGGAAGAAAGATGG + Intronic
985143085 4:186863176-186863198 CAGGTGCAATGTAGAGAAGTGGG - Intergenic
985230041 4:187805818-187805840 TAGTGAGAATGCAGAGAAGAGGG + Intergenic
985253406 4:188045083-188045105 CAGTGGCAGAGGAAAGAAGTGGG + Intergenic
985427369 4:189843902-189843924 CAGATGCAGTGGAGGGAAGAAGG - Intergenic
986494659 5:8330455-8330477 CAATGGCAAGGAAGAGGAGATGG - Intergenic
986831433 5:11583419-11583441 CAATGCCCATGGATAGAAGAAGG + Intronic
988285999 5:29217133-29217155 CAGTGGAAATGAAGAGCAGCTGG - Intergenic
988918489 5:35919858-35919880 CAGTGGGTATGGGGTGAAGATGG + Intronic
988930552 5:36032195-36032217 CAGTGGCAATGACGAAAACAAGG + Intergenic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
989993134 5:50792779-50792801 CAGTGGAAGTGGTGAGAAAAGGG - Intronic
990162334 5:52956132-52956154 CTGTGGCCTTGGAGAGAACATGG - Exonic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
990986231 5:61643251-61643273 CAGGAGCAAGAGAGAGAAGAGGG - Intronic
990994008 5:61712982-61713004 CAGTGGCTAGGGAGAGAGGCTGG + Intronic
991662256 5:68962197-68962219 CAATGAGAATGGAGAGAAGTAGG + Intergenic
992736835 5:79730199-79730221 CAGTGTCAAAGGAGAGAAGGAGG + Exonic
993129987 5:83884244-83884266 AAGTGGCAAGGCAGAGGAGAAGG - Intergenic
993852079 5:93023184-93023206 CAGTCCCAATGGAGAGCAGCAGG - Intergenic
993879501 5:93346153-93346175 CAATAGCAATGGACAGAATAAGG - Intergenic
994185242 5:96808430-96808452 CACTGGCAGTGGCGAGATGACGG - Intergenic
994425582 5:99581237-99581259 CAGGGGAAATTGATAGAAGAAGG - Intergenic
994435759 5:99731004-99731026 CAGGGGAAATTGATAGAAGAAGG + Intergenic
995441775 5:112200162-112200184 CATTGGGAATGGAAAGAAGCAGG - Intronic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
996339006 5:122415568-122415590 AGTTGGAAATGGAGAGAAGAGGG + Intronic
996516325 5:124373404-124373426 GAGTGGTAATAGAAAGAAGATGG - Intergenic
997456030 5:134018243-134018265 CAGGAGCAAGGGAGAGAAGGAGG + Intergenic
997660472 5:135585457-135585479 GAGTGGCACTGGAGACAACAAGG - Intergenic
997976776 5:138445666-138445688 CAGTGGCTGTGGAAAGAAGGAGG - Exonic
998174754 5:139894918-139894940 CAGCTGCAAGGTAGAGAAGAGGG + Intronic
998209470 5:140183397-140183419 AAGTGAGAATGGAGAGAAAATGG - Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998876745 5:146607845-146607867 CAGTTGTAATGGAGACCAGATGG - Intronic
1000003391 5:157161760-157161782 TAGTGGCAATGGAGACCATATGG - Intronic
1000116466 5:158158624-158158646 TAGTGGGAATGAAGAGAAGAGGG - Intergenic
1000440709 5:161259790-161259812 CAGGGGCAAGGGTCAGAAGAGGG - Intergenic
1000790907 5:165605987-165606009 CAGTGGTAATGGTGAGCAGAAGG - Intergenic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002212341 5:177606478-177606500 CAGTGGCAACAGCGAGAAGCGGG - Intronic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002606404 5:180385367-180385389 CGGTGGAGATGGGGAGAAGATGG + Intergenic
1002932818 6:1646162-1646184 AAGTGGCAAAATAGAGAAGAAGG - Intronic
1002968789 6:1993127-1993149 CTGGGGCAAGGGAGAGGAGATGG - Intronic
1003484870 6:6566970-6566992 CTGTGGCAAAGGAAAGAAGTCGG - Intergenic
1003516171 6:6820892-6820914 CAGGGGCAATGCAGGGGAGAGGG + Intergenic
1005486159 6:26301897-26301919 CAGTGGCTGGGGAGAGAAGCAGG - Intergenic
1005646797 6:27847039-27847061 CACTGGCAATGGAAAGTAAAGGG - Intronic
1006376929 6:33676881-33676903 CAGTGGCAAGGGTGAGGAGGTGG + Exonic
1006625500 6:35394884-35394906 CAGTGGCAATGCTGAGATGAGGG - Intronic
1007452066 6:41947744-41947766 AAGTGGAAATCGAGAAAAGAAGG - Intronic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1008356898 6:50565663-50565685 CAGTGGCTATGGAGAGCCGGAGG - Intergenic
1008555918 6:52672736-52672758 CAATGAGAATGGAGAGAAGGTGG - Intronic
1008977526 6:57445522-57445544 CAGTGGCAAAGGAACAAAGATGG - Intronic
1009370125 6:62889123-62889145 CCGTGGGAAGAGAGAGAAGAGGG + Intergenic
1009618130 6:66037595-66037617 CAGTTGCAAAAGAGAGAAGTGGG + Intergenic
1009822334 6:68819225-68819247 CAGTTTCAATGGAGTGAAAAGGG - Intronic
1010306449 6:74328765-74328787 CAATGGGAATGAAGAGAAGTTGG - Intergenic
1011064592 6:83311485-83311507 CTGTGGCAAATGACAGAAGAGGG + Intronic
1011575019 6:88787792-88787814 CAGTGACAATGGAGAAAAAAGGG + Intronic
1012027438 6:94014752-94014774 CGGTAGCAAAGGAAAGAAGAAGG - Intergenic
1012241253 6:96875505-96875527 CAGTAGAAATGGAGAAAAGATGG - Intergenic
1012289108 6:97429200-97429222 AAGTGGGAGTGTAGAGAAGACGG + Intergenic
1012310475 6:97718309-97718331 CAGTAGGAATGGACAAAAGAGGG + Intergenic
1013453533 6:110308946-110308968 GACTGGGGATGGAGAGAAGAGGG + Intronic
1013461107 6:110376371-110376393 TAGTGGCAGTGGAGAGGGGAAGG + Intergenic
1013732209 6:113181779-113181801 CATTGACAATGGAGAGAATAGGG + Intergenic
1014639996 6:123897801-123897823 CAGAGGCAGTGAAGGGAAGAGGG - Intronic
1014848727 6:126313507-126313529 CAGTGTCAGAGGAGGGAAGAGGG - Intergenic
1015495984 6:133883872-133883894 CAGAGGAAATGGTGAGAAGAGGG + Intergenic
1015857460 6:137640587-137640609 CAAAGGGAATAGAGAGAAGAGGG - Intergenic
1016099636 6:140082744-140082766 CAATGGAAATGGTGAGAAGAAGG + Intergenic
1016520388 6:144940320-144940342 GAGAGGCAATGGAGAAAAGCAGG - Intergenic
1016604726 6:145907295-145907317 CGGTAGAAATGGAGAGAAGTGGG - Intronic
1016838242 6:148501151-148501173 AAATGGCAATGGAGGGAAGGTGG - Intronic
1016850004 6:148609141-148609163 CAATGGCAATGCAGAAAAGGTGG - Intergenic
1016888309 6:148980318-148980340 CAGCAGCCGTGGAGAGAAGATGG - Intronic
1017123504 6:151045497-151045519 CAGGAGCATTGGAGAGACGAGGG - Intronic
1017523359 6:155221482-155221504 CTGTTTCAATGGAGAGAAAAAGG - Intronic
1017667678 6:156736923-156736945 GAATGGAAATGGAGAGAACAAGG + Intergenic
1017703300 6:157096563-157096585 CTGTGGCAATGTGGAGAGGAAGG - Intronic
1018309326 6:162492030-162492052 CAGAGGAAATGGAAACAAGATGG + Intronic
1018353599 6:162989096-162989118 CAGTGAGAATGTAGAGAAGGGGG + Intronic
1018498590 6:164378000-164378022 CAAGGGCAAAGGAGAGAAGCTGG - Intergenic
1018651845 6:165998908-165998930 CACTGGGAATGGAGAGAAGGAGG - Intergenic
1019862530 7:3673331-3673353 CAGTGTCAATAGAGACAAAAGGG + Intronic
1020346088 7:7165140-7165162 CAGTAGCCAGGAAGAGAAGATGG + Intronic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1021418583 7:20419144-20419166 CATTTGTAATGGAGAGGAGAAGG + Intergenic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022255224 7:28649455-28649477 CAGTTGCAATGGAGAACAGATGG + Intronic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024777323 7:52802649-52802671 CAGTGGAATAGGAGAGAAGATGG - Intergenic
1024817797 7:53291879-53291901 CAGAGGCAGTGCAGAGATGATGG + Intergenic
1025842668 7:65165654-65165676 CAGTGGAAATGGAGAAGGGATGG - Intergenic
1025880377 7:65530314-65530336 CAGTGGAAATGGAGAAGGGATGG + Intergenic
1025893060 7:65672290-65672312 CAGTGGAAATGGAGAAGGGATGG - Intergenic
1026028366 7:66766681-66766703 CAGTGGGAATGGAAAGACGACGG - Intronic
1026372504 7:69715629-69715651 CAGTCAAAATGGAGAGATGAAGG + Intronic
1026391560 7:69907781-69907803 CAGAGGCAAACAAGAGAAGAAGG + Intronic
1026806280 7:73431122-73431144 TGGTGGCAATGGTGAGAAAATGG - Intergenic
1027261507 7:76468057-76468079 CGGGGGGAATGGAGAGAGGAGGG + Intronic
1027968914 7:85051466-85051488 CAGAGGCAATTGAGAGGAAATGG - Intronic
1028913844 7:96237289-96237311 TGGTGACAATGGAGAGAGGAGGG + Intronic
1029635592 7:101781592-101781614 CAATGGCATGGGAGAGAACATGG + Intergenic
1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG + Intronic
1031196053 7:118615328-118615350 CAGTGGAAGTAAAGAGAAGAGGG + Intergenic
1031458577 7:122015102-122015124 AAATGCCAATGGAAAGAAGAGGG + Intronic
1032261890 7:130345027-130345049 CAGTAGCAATGGAGATAAAAGGG - Exonic
1032318650 7:130864771-130864793 CAGGGGGAATGAAGAGAAGTTGG + Intergenic
1032417481 7:131747594-131747616 CAGAGGTATTGGAGAGGAGATGG + Intergenic
1032522836 7:132559377-132559399 CAGAAGCAATCCAGAGAAGAGGG + Intronic
1032607037 7:133366932-133366954 CCGTGGCAATGGAGTGAAGGAGG + Intronic
1032804584 7:135341448-135341470 CAAGGGCAAAGGAGAGAAAAGGG + Intergenic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1033579721 7:142721065-142721087 CAGTGTCTCTAGAGAGAAGAAGG + Intergenic
1033654621 7:143364256-143364278 CAGTCGCAAAGGAAAGAAGATGG + Intergenic
1033735452 7:144217415-144217437 CTGTGGCAGTGGAGAGGATATGG + Intergenic
1033747602 7:144333554-144333576 CTGTGGCAGTGGAGAGGATATGG - Intergenic
1035121628 7:156573163-156573185 CTGCGGCAATGGAGGGCAGAGGG + Intergenic
1035386869 7:158478865-158478887 CAGTGGGAATGGGGCAAAGATGG + Intronic
1036220174 8:6914849-6914871 GAATTGCAATGGAGAGAATAGGG + Intergenic
1037061027 8:14509821-14509843 AAGTGGCAGGAGAGAGAAGAGGG + Intronic
1038542601 8:28402193-28402215 CAGCGTCGGTGGAGAGAAGAGGG + Intronic
1039103747 8:33967925-33967947 CAGTGGGGATGGAGCCAAGATGG - Intergenic
1039158719 8:34592956-34592978 GAGTGGCAATGGAGAGATGTTGG + Intergenic
1039254541 8:35704769-35704791 CAGGGGGAATGGGGAGAACAGGG + Intronic
1039447785 8:37646474-37646496 CAGGGGCAAGAGAGAGAGGAGGG + Intergenic
1039792956 8:40890486-40890508 CAGTGGCAATGGGGAGGGGGAGG - Intronic
1043199717 8:77351376-77351398 TAGTTGGAATGGAGATAAGATGG - Intergenic
1044483256 8:92718082-92718104 CTGTGGCAGTGGAGAGATAATGG - Intergenic
1044512382 8:93097358-93097380 CAGTGGCAAAGGAGGGAGAAAGG + Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1044848783 8:96407831-96407853 CAGTGGTAATGAAGAGATGATGG + Intergenic
1044876241 8:96669444-96669466 CAGGGGCAATGGAGAGTGGGAGG - Intronic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045863622 8:106840256-106840278 CAATGAGGATGGAGAGAAGATGG - Intergenic
1046780164 8:118206146-118206168 CATTGGAAATGGAGACAAGCTGG - Intronic
1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG + Intergenic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047224903 8:122947985-122948007 CAGGGGCAAACCAGAGAAGAGGG - Intronic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1047973444 8:130106914-130106936 CACTGGAAATGTAAAGAAGAAGG - Intronic
1048001992 8:130386205-130386227 CAGTGGTGATGCAGAGAAAAGGG + Intronic
1048184729 8:132229360-132229382 CAGTGGCAATGGACAGCAAGAGG + Intronic
1048196409 8:132335401-132335423 CAGTGAGACTGGAGAGAAGTTGG - Intronic
1048443462 8:134476766-134476788 CAGTGGCATTTGATAGAGGAGGG - Intergenic
1048457056 8:134587741-134587763 ATGAGGGAATGGAGAGAAGAAGG - Intronic
1048575247 8:135685032-135685054 CAGTGGCTGTGGAGAGAACCGGG - Intergenic
1049069979 8:140349033-140349055 CCTTGGCAAGGGAGAGGAGAGGG + Intronic
1049616903 8:143579510-143579532 CTTTTGCAATGGAAAGAAGAGGG + Intergenic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1050580041 9:7044494-7044516 CAGTGATGATGGAGAGAACAGGG + Intronic
1050806715 9:9689643-9689665 CAGAGGCCATGAAGAGTAGAGGG - Intronic
1053040584 9:34867395-34867417 CAGAGGTAATGGAGAGAGGTGGG + Intergenic
1054714676 9:68545768-68545790 TAGTGGCAAGGGGGAGAAAATGG - Intergenic
1055318413 9:75057240-75057262 CAGTGGGAAGGGGGAGAAGAGGG + Intergenic
1056242135 9:84658408-84658430 CAGGGGCAAAGTAGAGAAAATGG - Intergenic
1056529999 9:87478665-87478687 CAGGGGCAATGGGGAGAACAGGG + Intergenic
1056592178 9:87972638-87972660 CTGTGGCTATGGAGAGCAGTGGG + Intronic
1057133925 9:92673245-92673267 CAGTGGGAATGCAGAGGAGAGGG + Intergenic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1058305202 9:103432924-103432946 CAGAAGAAATGGAGAAAAGATGG - Intergenic
1058843747 9:108934964-108934986 CAGTAGGGATGGCGAGAAGAGGG + Intronic
1058844634 9:108944719-108944741 CAGTAATAATGGAGAGAACAGGG + Intronic
1058880827 9:109284832-109284854 CAGTGGCAATGGATAGTAATAGG - Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059299537 9:113300946-113300968 CAGTGGCAGAGGAGATAAAAGGG + Intronic
1060100345 9:120834864-120834886 CAGTGAGGATAGAGAGAAGAGGG + Intronic
1060267333 9:122120055-122120077 CAGGGACAAGGGAGAGGAGAGGG - Intergenic
1060550683 9:124483640-124483662 CAGTGATGATGGAGACAAGATGG - Intronic
1061498375 9:130988868-130988890 AAGTGGCAATGGAGAGAGGATGG + Intergenic
1203656889 Un_KI270753v1:6620-6642 TATTGCCAATGGAGACAAGAGGG + Intergenic
1187222336 X:17340324-17340346 CAGTGGCCATTGGGAGATGATGG - Intergenic
1187359886 X:18616149-18616171 CAATAGCTATGGAGAGAAGCAGG + Intronic
1187452858 X:19413853-19413875 AAGGGGAAAAGGAGAGAAGAAGG + Intronic
1187984662 X:24797217-24797239 CAGGGGAAATGGAGAGAGGGTGG - Intronic
1189155730 X:38755213-38755235 CACTGGCAATGAAGAGAGGGTGG + Intergenic
1189161116 X:38809907-38809929 CATTGGCAATGCAGAACAGAGGG - Intergenic
1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG + Intergenic
1189809954 X:44772713-44772735 TAGTGGTGATGGAGAGAAAAAGG - Intergenic
1189986886 X:46561485-46561507 AAGTGGCAGAGGAGAGCAGAGGG - Intergenic
1190262326 X:48805267-48805289 CAGTGGCAGTGGTGAGGAGAGGG + Intronic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1192163193 X:68803982-68804004 CAGTGAGAATGGAGAGGAGGGGG + Intergenic
1192185626 X:68945003-68945025 CAGTGGCTGTGGAGTAAAGACGG + Intergenic
1192491419 X:71579543-71579565 CAGTGGCTGTGGGGAGAAGTGGG + Intronic
1193214664 X:78849529-78849551 GAGTTGGAATGGAGAGAAAATGG + Intergenic
1194668694 X:96704414-96704436 CAGTAGCAAGGGGGAGAAAAAGG - Intronic
1194677244 X:96809166-96809188 AAGTTGCAATGGAGAGAAGACGG - Intronic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195840304 X:109168606-109168628 CAGTGCCAATGCAGAGAAAGAGG - Intergenic
1195910881 X:109887399-109887421 CAGTGTCAAGGGAGAGAAAAAGG - Intergenic
1195938859 X:110150297-110150319 CTGTGGCAATGGGGAGCACAAGG + Intronic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196649010 X:118149851-118149873 CAGTGGATACGGGGAGAAGATGG - Intergenic
1197129506 X:122988815-122988837 CTGTAGCAATGGAGAAAAGATGG - Intergenic
1197646144 X:129019079-129019101 CAGAGGCAGAGGAGAGAGGATGG - Intergenic
1197750557 X:129961059-129961081 CAGTGCCAAGGCAGAGAGGAAGG + Intergenic
1198329970 X:135613368-135613390 CAATGCCCATGAAGAGAAGATGG + Intergenic
1198332932 X:135638487-135638509 CAATGTCCATGAAGAGAAGATGG - Intergenic
1198337030 X:135676397-135676419 CAATGCCTATGAAGAGAAGATGG - Intergenic
1199066711 X:143427644-143427666 AAGAGGCAAAGGAGAGAAAAAGG - Intergenic
1199316543 X:146385336-146385358 AAGTAGGAATAGAGAGAAGATGG + Intergenic