ID: 966969512

View in Genome Browser
Species Human (GRCh38)
Location 3:185030357-185030379
Sequence AAACCAGGGGTTGCTCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 178}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966969512_966969519 19 Left 966969512 3:185030357-185030379 CCTCTCTGAGCAACCCCTGGTTT 0: 1
1: 0
2: 2
3: 5
4: 178
Right 966969519 3:185030399-185030421 GGTGTGTTTGCAGAAGCTGAGGG 0: 1
1: 0
2: 0
3: 20
4: 283
966969512_966969518 18 Left 966969512 3:185030357-185030379 CCTCTCTGAGCAACCCCTGGTTT 0: 1
1: 0
2: 2
3: 5
4: 178
Right 966969518 3:185030398-185030420 TGGTGTGTTTGCAGAAGCTGAGG 0: 1
1: 0
2: 1
3: 25
4: 274
966969512_966969516 -2 Left 966969512 3:185030357-185030379 CCTCTCTGAGCAACCCCTGGTTT 0: 1
1: 0
2: 2
3: 5
4: 178
Right 966969516 3:185030378-185030400 TTTAGATCCGCTTTCTCTGCTGG 0: 1
1: 0
2: 1
3: 6
4: 99
966969512_966969520 20 Left 966969512 3:185030357-185030379 CCTCTCTGAGCAACCCCTGGTTT 0: 1
1: 0
2: 2
3: 5
4: 178
Right 966969520 3:185030400-185030422 GTGTGTTTGCAGAAGCTGAGGGG 0: 1
1: 0
2: 4
3: 26
4: 271
966969512_966969521 25 Left 966969512 3:185030357-185030379 CCTCTCTGAGCAACCCCTGGTTT 0: 1
1: 0
2: 2
3: 5
4: 178
Right 966969521 3:185030405-185030427 TTTGCAGAAGCTGAGGGGCCAGG 0: 1
1: 0
2: 2
3: 34
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966969512 Original CRISPR AAACCAGGGGTTGCTCAGAG AGG (reversed) Intronic
901510768 1:9717130-9717152 AAAGAAGGGGTGGCTCAGAGGGG - Intronic
901924450 1:12557025-12557047 AGACCAGGGGTTCCTGACAGGGG + Intergenic
901925237 1:12561774-12561796 GAACCAGAGGTGGCTCAGACTGG - Intergenic
904569022 1:31446893-31446915 ATGCCAGTGGCTGCTCAGAGAGG + Intergenic
905631107 1:39519015-39519037 AAGCCAGGCCTGGCTCAGAGGGG + Intronic
905666652 1:39767156-39767178 AAGCCAGGCCTGGCTCAGAGGGG - Intronic
907020159 1:51059412-51059434 GACCAAGGGGTTGCTCAGGGTGG + Intergenic
907851290 1:58257690-58257712 AAACTAGGGGTTACTCTAAGTGG - Intronic
908075164 1:60509337-60509359 AAACCAAGGGTTGGTGAGATGGG - Intergenic
920180674 1:204130117-204130139 ATTCCAGAGGTGGCTCAGAGAGG + Intergenic
920290726 1:204921272-204921294 AAAACAGGAGTTGCTGGGAGTGG - Intronic
921313583 1:213869812-213869834 AAACCAGGAGAGGCTCAGATGGG - Intergenic
922386172 1:225086084-225086106 ACACGTGGGGTTGCTCAGTGAGG - Intronic
922701080 1:227761427-227761449 AAGTCAGGGGTTGCAAAGAGAGG + Intronic
1066192095 10:33065466-33065488 AAACCAGAGTAGGCTCAGAGAGG - Intergenic
1075839502 10:125487741-125487763 GAAGCTGGGGTAGCTCAGAGTGG + Intergenic
1075988541 10:126811216-126811238 AAAACAGAGGTTTCTCAGACTGG + Intergenic
1079126209 11:17720202-17720224 AAACCAGCGGTTGCCCAAGGTGG + Exonic
1079748491 11:24163463-24163485 AAACCAGGAGTTGTCCATAGAGG - Intergenic
1080867456 11:36207839-36207861 AACACGGGGGCTGCTCAGAGAGG + Intronic
1080874274 11:36262148-36262170 AAACCAGGGGCTGAGCACAGTGG + Intergenic
1081406720 11:42707133-42707155 GGACCAGGAGGTGCTCAGAGAGG - Intergenic
1081840666 11:46199124-46199146 AAACCAGGGGATTATCAGACAGG - Intergenic
1083142944 11:60736562-60736584 AAACCAGGGGCTGAGCAGTGTGG - Intronic
1083902291 11:65649532-65649554 AGAGCAGGGGTGGCTCAGAAAGG - Intronic
1084211834 11:67627993-67628015 AAGCCAGGGGCTGCTTAGGGCGG + Exonic
1084369533 11:68731135-68731157 AAAGCAGAAGTTGCTAAGAGTGG + Intronic
1092694262 12:11151341-11151363 ACACCAGGGGCTGGTTAGAGAGG + Intronic
1096428751 12:51525856-51525878 AAACCAGTGGTCTCTGAGAGTGG - Intergenic
1097604522 12:61736088-61736110 AAGCCAGGGATTGCTGAGAAGGG - Intronic
1097680497 12:62644694-62644716 AAACCAAAGTCTGCTCAGAGAGG + Exonic
1099481130 12:83168003-83168025 CAACCTGGGGTTGCTAAGGGAGG + Intergenic
1101899173 12:108778482-108778504 GAAGCAGTGGATGCTCAGAGAGG - Intergenic
1102237025 12:111299810-111299832 AACCCAGGGGCTGGTGAGAGAGG - Intronic
1102918706 12:116775572-116775594 AAACTAGGGAAGGCTCAGAGAGG - Intronic
1104777500 12:131399799-131399821 CAACCAGTGTTTACTCAGAGAGG - Intergenic
1106731613 13:32547225-32547247 AAAACAGGGGCTGGTCACAGTGG + Intergenic
1110854412 13:80280239-80280261 AAAACATGGGCAGCTCAGAGAGG + Intergenic
1114545156 14:23494526-23494548 TAACCAGGAGCTGCTGAGAGAGG + Intronic
1114670848 14:24410158-24410180 AAACCAGGGGTTGCGGCGAGTGG + Exonic
1116127668 14:40808753-40808775 AAAGCAGGGATTTCTCAAAGGGG + Intergenic
1117534495 14:56690681-56690703 AAGCAAGAGGTTCCTCAGAGAGG - Intronic
1118726212 14:68630769-68630791 AAACCAGGGGTTGGTTCAAGGGG - Intronic
1119479528 14:74950920-74950942 AAATGAGGGGTTGCTGGGAGAGG - Intronic
1120723936 14:87916823-87916845 AGACCAAGGGTTGCTCAGGTCGG + Intronic
1121834605 14:97080507-97080529 AAACCAGAGAGGGCTCAGAGAGG - Intergenic
1122017036 14:98804994-98805016 AAATGAGGGGTTGTTCAGTGGGG + Intergenic
1122706305 14:103624273-103624295 CAACCAGGGCTTGCTGAGACAGG + Intronic
1123411606 15:20065712-20065734 TTACCAGGGGTTACTCAGGGGGG + Intergenic
1123520952 15:21072831-21072853 TTACCAGGGGTTACTCAGCGGGG + Intergenic
1124077712 15:26461784-26461806 AGACCAAGGGATGCTCAGATTGG - Intergenic
1126119057 15:45234895-45234917 ATTCCACGGGTTGCTCAGGGAGG - Intergenic
1127045609 15:55022286-55022308 AAACCAGGTGTTAAGCAGAGTGG - Intergenic
1127292370 15:57581953-57581975 GGACCAGGGTCTGCTCAGAGGGG - Intergenic
1130617875 15:85429653-85429675 AAACCATTGGCTGTTCAGAGTGG + Intronic
1132509216 16:328929-328951 CACCCAGGGGTTGTGCAGAGAGG - Intronic
1134079201 16:11313304-11313326 ACACAAGGGATTGATCAGAGAGG + Intronic
1134805446 16:17120287-17120309 AAACCAAGAGTTGCTGAAAGGGG - Intronic
1135344663 16:21678760-21678782 AAGCCACGGTTTTCTCAGAGTGG + Intronic
1136004263 16:27317764-27317786 AAACAAAGGGAGGCTCAGAGAGG - Intronic
1136859096 16:33685648-33685670 ACACCCAGAGTTGCTCAGAGAGG + Intergenic
1139002117 16:62524814-62524836 AAAACGGTGCTTGCTCAGAGAGG - Intergenic
1139949695 16:70663029-70663051 AAACCAGGGGCTGCTTGGGGGGG - Exonic
1140885334 16:79237864-79237886 AGACCAGGGGTCCCTCACAGGGG - Intergenic
1142357623 16:89609917-89609939 AAACCATGGGTTGGACACAGTGG - Intergenic
1203120608 16_KI270728v1_random:1533832-1533854 ACACCCAGAGTTGCTCAGAGAGG + Intergenic
1143610945 17:8016999-8017021 AAAAGAGGGGTATCTCAGAGGGG - Intronic
1144779296 17:17799836-17799858 GGAGCAGGGGCTGCTCAGAGGGG - Intronic
1145249966 17:21291935-21291957 AAACCGAGGCTTGCACAGAGAGG + Intronic
1146469452 17:33112189-33112211 AAACCACTGGTTCCTGAGAGCGG - Intronic
1146984503 17:37202110-37202132 AAAGGAGGGGTTTCTCAGTGTGG + Intronic
1148342678 17:46882943-46882965 ACCCCTGGGGTTGCCCAGAGGGG - Intronic
1148533799 17:48420955-48420977 AAACCAGTGGTTGCCAACAGGGG - Intronic
1148735150 17:49860973-49860995 AAACCAGGGGTTACTCCATGGGG - Intergenic
1148791869 17:50177861-50177883 AAACCAGGAGTTGCGCAGACCGG + Intergenic
1150228075 17:63534529-63534551 TTACCAGGGCCTGCTCAGAGAGG - Intronic
1150889905 17:69135720-69135742 AGACCAGGGGTTCCTAATAGTGG - Intronic
1151539647 17:74758523-74758545 AAATCAGGATCTGCTCAGAGAGG - Intronic
1151979865 17:77502378-77502400 GAGCCAGGGGGTGCCCAGAGAGG - Intergenic
1152258298 17:79252978-79253000 GAAGCAGAGGCTGCTCAGAGAGG - Intronic
1152546297 17:81001613-81001635 ACACAAAGGGTGGCTCAGAGTGG + Intronic
1152641151 17:81449799-81449821 AAGCCAGGAGGTGCTCGGAGGGG - Intronic
1152807393 17:82362642-82362664 ATAGCAGGGGTTTCTCAAAGTGG + Exonic
1157347716 18:46854798-46854820 AAAGCAGAGGCTGCTGAGAGTGG - Intronic
1158957753 18:62556862-62556884 AATCCAGGGATAGATCAGAGTGG - Intronic
1159047488 18:63383102-63383124 AGACCTGGGGTTGCTCCAAGTGG - Intergenic
1161124292 19:2547126-2547148 CAATCAGGGGCTTCTCAGAGGGG - Intronic
1161249349 19:3271762-3271784 AAATAAGGGGTTGCTGAGGGTGG + Intronic
1161474874 19:4479024-4479046 ACTCAAGGGGTTGCTCAGATGGG + Intronic
1163694914 19:18759317-18759339 AAGCCAAGAGTTGCACAGAGAGG - Intronic
1166892116 19:46000145-46000167 AGAGGAGGGGTTGTTCAGAGAGG + Intronic
1167180686 19:47901112-47901134 AAAAAAGGGGGTGTTCAGAGTGG + Intergenic
1167499549 19:49837457-49837479 AAACCATGGGCTGCTCAGTTTGG - Intronic
925946431 2:8868180-8868202 AAAACAGGTGGTGATCAGAGAGG - Intronic
928033077 2:27797900-27797922 AAGCCAGGGGCTGCTCAGAGAGG + Intronic
928180836 2:29067187-29067209 AAGCCAGAGGCTGCTCAGAACGG - Intronic
929024787 2:37589565-37589587 AAAGCAGGGGTTGGACAGTGAGG - Intergenic
929595944 2:43175993-43176015 GAAAAAGGGATTGCTCAGAGAGG - Intergenic
929671868 2:43882345-43882367 GGACCAGGGGTTCCTCATAGTGG + Intergenic
929770655 2:44888833-44888855 AAACCAAGTGAGGCTCAGAGAGG - Intergenic
929777545 2:44938450-44938472 CACCCTGGGGTCGCTCAGAGCGG - Intergenic
933697603 2:85231570-85231592 ACACCAGCGGTGGCCCAGAGTGG - Intronic
933793983 2:85905660-85905682 AAAACAGGAATTGCTCAGAAAGG - Intergenic
934650241 2:96086355-96086377 GAACCCAGGGTGGCTCAGAGTGG + Intergenic
935486053 2:103655492-103655514 GAACAAGGGTTTCCTCAGAGGGG + Intergenic
935672839 2:105570491-105570513 TCACCAGGTGTTGCTCTGAGGGG - Intergenic
936481378 2:112888244-112888266 AAACCAAGGGATGTTTAGAGTGG + Intergenic
941675156 2:168336437-168336459 AAGCAAGGAGATGCTCAGAGAGG + Intergenic
941799961 2:169648272-169648294 AAAACAGAGGTTACTCAGACTGG + Intronic
942327987 2:174791734-174791756 AAACCAGGGGGTTTCCAGAGTGG + Intergenic
943113840 2:183641841-183641863 AAATGAGGTGTTGCTCAGATTGG - Intergenic
1173224625 20:41155002-41155024 AGACCAGCAGTTACTCAGAGCGG - Intronic
1175516319 20:59572348-59572370 AGCCCAGGGGCTGCTTAGAGGGG + Intergenic
1179245501 21:39630712-39630734 AAAGCTGGGATTGCTGAGAGTGG + Intronic
1179712678 21:43272393-43272415 AGACCAGGGGGTGCTCACTGAGG + Intergenic
1180183148 21:46126890-46126912 AATCCAGGGCTTCCTCCGAGTGG - Intronic
1183219156 22:36501178-36501200 AAACCCTGGGATGCTGAGAGTGG + Intronic
1183431284 22:37767378-37767400 AAACCATGGGTGGCCCTGAGTGG + Intronic
1184506407 22:44906447-44906469 GTAACAGGGCTTGCTCAGAGAGG + Intronic
951718507 3:25674040-25674062 AGGCCAGGGGTTGCTGAGGGTGG - Intergenic
953604063 3:44397314-44397336 AGACCAGTGGTTGCTTGGAGAGG - Intronic
956778378 3:72585472-72585494 AAAGCAATGGTTGCTCAAAGGGG - Intergenic
959085990 3:101850735-101850757 AAAACAGGAGTGGCTAAGAGTGG - Intronic
959473771 3:106785031-106785053 AAAACAATGGATGCTCAGAGAGG - Intergenic
960617322 3:119607785-119607807 AACCCAGGGGTAGCTAATAGAGG + Intronic
962242669 3:133764382-133764404 AAAGTAGGAGGTGCTCAGAGAGG - Intronic
964876428 3:161372758-161372780 AGAGCAGGGCTTGCTGAGAGTGG + Exonic
966969512 3:185030357-185030379 AAACCAGGGGTTGCTCAGAGAGG - Intronic
969385630 4:6845042-6845064 AAACCAGAGTTTGGACAGAGAGG - Intronic
973289845 4:48460090-48460112 AAACCAGAGGGAGCACAGAGAGG + Intergenic
975459716 4:74636742-74636764 ATACCAGGGCTTGTTCTGAGGGG - Intergenic
977595197 4:98871794-98871816 AAACCAGGGTTCTCTCAAAGTGG - Intronic
982718589 4:158836201-158836223 CAGCCAGGCGTTGCTCAGACTGG + Intronic
986000872 5:3629636-3629658 AAACCAGGAGATTCCCAGAGAGG + Intergenic
989291297 5:39769403-39769425 AAACCAGAGGTGGCTCCGGGTGG - Intergenic
991113946 5:62931718-62931740 ACACCTGGGCATGCTCAGAGAGG - Intergenic
991421977 5:66451449-66451471 AAACCAGAGACTGCTAAGAGGGG + Intergenic
995980922 5:118103264-118103286 AAGCCATGGTTTGCTGAGAGAGG - Intergenic
997037964 5:130215424-130215446 AAACCAGGAGTTTCTCTGAGAGG + Intergenic
1000246147 5:159449991-159450013 ACCCCAGTGGTTCCTCAGAGAGG - Intergenic
1000358108 5:160420362-160420384 AAAACAGTGGTTATTCAGAGAGG + Intronic
1000816275 5:165926501-165926523 AAACTAAGAGTTGCTCATAGAGG - Intergenic
1005276970 6:24229907-24229929 AAACCATGGGTCTCTCAAAGGGG - Intronic
1005733313 6:28720349-28720371 ATAGCAGTGATTGCTCAGAGTGG - Intergenic
1006147372 6:31967696-31967718 AGACCTGGGGGTGGTCAGAGAGG - Exonic
1007585249 6:42985112-42985134 AGACAAGGGGCTGCTCAGGGCGG - Intronic
1013070089 6:106721293-106721315 AAAGCAGGGGTGGCGCAGTGCGG + Intergenic
1013070277 6:106723022-106723044 AAAGCAGGGGTGGCGCAGTGCGG - Intergenic
1016921259 6:149296315-149296337 AGTCCAGAGCTTGCTCAGAGTGG - Intronic
1017177711 6:151520254-151520276 GAAACAGGGGTTGCTGTGAGAGG + Intronic
1018638636 6:165886547-165886569 AATCCAGAAGTTGCTCAGTGAGG + Intronic
1018685254 6:166299053-166299075 AGTCCAGAGCTTGCTCAGAGAGG + Intergenic
1019003364 6:168775243-168775265 AGACCAGGGGTTGCTGAGAGAGG + Intergenic
1020185058 7:5952633-5952655 AAAAAAGGAGTTGCTCACAGAGG + Intronic
1020297858 7:6772111-6772133 AAAAAAGGAGTTGCTCACAGAGG - Intronic
1021553231 7:21894174-21894196 AAACCAGGGGCTGGGCACAGTGG - Intronic
1024777774 7:52807919-52807941 ACACCAGCTGGTGCTCAGAGGGG + Intergenic
1027232840 7:76282282-76282304 TAACCGGGGGTAGCTCAGGGTGG - Intronic
1029900719 7:104036439-104036461 AGCCCAGGGGTTGCCCAAAGTGG - Intergenic
1033709692 7:143929359-143929381 AAACCAGAGGATGCTAGGAGGGG + Intergenic
1033912293 7:146279129-146279151 ACAACAGGAGTTTCTCAGAGAGG - Intronic
1035042007 7:155935897-155935919 AGACCAGGGGCTGCAGAGAGAGG + Intergenic
1037823011 8:22144348-22144370 AAAACAGAAGTGGCTCAGAGAGG - Intergenic
1039264382 8:35808859-35808881 AGACCAAGGGGTGCTCAGATTGG - Intergenic
1040710111 8:50177542-50177564 AGACCCTGGTTTGCTCAGAGAGG + Intronic
1041407187 8:57512987-57513009 ACACCAAGGGCTGCTCACAGGGG - Intergenic
1041662599 8:60414155-60414177 AACTCAGTGTTTGCTCAGAGAGG - Intergenic
1041730100 8:61054139-61054161 AATCCAGGGGTTGCTCCGTAAGG - Intergenic
1042491136 8:69399232-69399254 GTACCAGGGGCTTCTCAGAGAGG + Intergenic
1043943729 8:86226533-86226555 AAGCCAGAGGAGGCTCAGAGTGG - Intronic
1046615335 8:116471280-116471302 ACACCAGAGGAAGCTCAGAGAGG - Intergenic
1046785931 8:118266583-118266605 AAACCAAGTGTTGGTCAGTGAGG + Intronic
1049165026 8:141120304-141120326 AGAGCAGGCGTTGCTGAGAGTGG + Intronic
1050460820 9:5875954-5875976 CAAGCAGTGGCTGCTCAGAGGGG + Intergenic
1053303245 9:36966428-36966450 ACACCAGGTTCTGCTCAGAGAGG - Intronic
1055573505 9:77640777-77640799 AAATCAGCTGTTTCTCAGAGGGG - Intronic
1060695774 9:125707534-125707556 AACCCAGGTCTTTCTCAGAGAGG - Intergenic
1061203972 9:129152551-129152573 ACACCAGGGGTTGCCCAGTGGGG - Intergenic
1061595262 9:131624755-131624777 AAACCAGGGCTCCCGCAGAGGGG - Intronic
1061755260 9:132807934-132807956 AAATCAGCGGTGGCTCACAGTGG - Intronic
1187373394 X:18728791-18728813 AAACCAGAGGATGCTGAGACTGG + Intronic
1189208419 X:39262002-39262024 GATCCAGGGGTTCCTCACAGGGG + Intergenic
1190524131 X:51311150-51311172 AAACCAAGGGGTGCTCAGGTCGG + Intergenic
1191654958 X:63586240-63586262 AAACCAAGGGATGCTCAGGTCGG + Intergenic
1191727034 X:64292442-64292464 TCACCAGGGTTTGCACAGAGAGG + Intronic
1198418736 X:136447749-136447771 AAACGAAGTCTTGCTCAGAGAGG + Intergenic