ID: 966971408

View in Genome Browser
Species Human (GRCh38)
Location 3:185048770-185048792
Sequence CCTACGTACCATGAGCTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966971408 Original CRISPR CCTACGTACCATGAGCTGTG AGG Intronic
901235661 1:7666351-7666373 CCTGCGTCCTATGACCTGTGTGG - Intronic
903096480 1:20980325-20980347 CCTACTTACCATAAGCATTGGGG + Exonic
910169546 1:84362694-84362716 CCTCCGGACTCTGAGCTGTGTGG - Intronic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
1063031952 10:2244419-2244441 CCTACGAACCATGAGCCGATGGG + Intergenic
1069358304 10:67613192-67613214 GCTACGAACAAGGAGCTGTGAGG - Intronic
1076905864 10:133360687-133360709 CCTACGCACACTGAGCTGCGGGG + Intergenic
1079492370 11:21003120-21003142 CCTATGTTCCAGGATCTGTGCGG + Intronic
1081620815 11:44618351-44618373 CCTGTGTACCAGGAGGTGTGCGG + Exonic
1093474101 12:19535629-19535651 CCTAGTTATAATGAGCTGTGTGG + Intronic
1105277853 13:18946667-18946689 CATACATACCATAAGCTGGGTGG + Intergenic
1105996114 13:25673678-25673700 CCTACGCACCAATAGCTGTTTGG - Intronic
1108385538 13:49896106-49896128 CCTACATACCAAGGGCTGTCTGG + Intergenic
1114284700 14:21229536-21229558 ACTACGTACCATATTCTGTGAGG + Intronic
1134156958 16:11851720-11851742 CCAGCTTTCCATGAGCTGTGGGG + Intergenic
1147595670 17:41715630-41715652 CCTACCTGCCACGAGGTGTGGGG - Exonic
1150133471 17:62681492-62681514 CCTACTTACCATGTACTGGGGGG + Intronic
1164112420 19:22180481-22180503 CTTATGTTCCATGAGCTTTGAGG + Exonic
1164112451 19:22180817-22180839 CTTATGTTCCATGAGCTTTGAGG + Exonic
1165948985 19:39462357-39462379 CATAGTTACCAGGAGCTGTGAGG - Intronic
931932906 2:67160921-67160943 ACAAAGTACCATGAACTGTGTGG - Intergenic
940098186 2:150002559-150002581 CCTAAGTACAATGATGTGTGAGG + Intergenic
941014919 2:160344752-160344774 GTTAGGTACCATGAGCTATGGGG + Intronic
1173078943 20:39847632-39847654 CCTATGTATGATGAGCTCTGAGG + Intergenic
1174687045 20:52466024-52466046 CCTACGGACCAGGCGCTGTGTGG + Intergenic
1177432455 21:21007675-21007697 CTAAGGTACTATGAGCTGTGAGG + Intronic
1179544764 21:42106633-42106655 GGTACGTACCATGTGCTGGGAGG + Intronic
1179913435 21:44461853-44461875 CCTCCGTGCTATGTGCTGTGGGG - Exonic
953044605 3:39283268-39283290 CCTACCACACATGAGCTGTGTGG - Intergenic
962930186 3:140028661-140028683 CCTATGGAGCATGAACTGTGGGG + Intronic
964250186 3:154706147-154706169 CCTAAGTAACATAAGCAGTGAGG - Intergenic
964530608 3:157663771-157663793 CCTACTAGCCATGAGCTGTCAGG - Intronic
966971408 3:185048770-185048792 CCTACGTACCATGAGCTGTGAGG + Intronic
967672982 3:192261065-192261087 CCTGCGTACCCTGTGGTGTGTGG - Intronic
977494808 4:97761557-97761579 ACTAAGTACCATAAGCTGGGTGG - Intronic
981502200 4:145463762-145463784 CCTACATACCTTGACCAGTGAGG - Intergenic
995999424 5:118341021-118341043 ACAAAATACCATGAGCTGTGTGG - Intergenic
1010274449 6:73952919-73952941 CCTAAGTCCCATGAGCATTGAGG - Intergenic
1015678587 6:135779266-135779288 ACAACGTACCATGGACTGTGTGG + Intergenic
1023811363 7:43914864-43914886 CCTGTGCACCATGACCTGTGCGG - Intronic
1028423721 7:90662688-90662710 GCTATGCACCATGAGCTGTTAGG + Intronic
1030945058 7:115708153-115708175 CCTTCGGATCATGAGCAGTGTGG - Intergenic
1035557715 8:579114-579136 CCTTGGTCCCATGTGCTGTGGGG - Intergenic
1056442476 9:86634600-86634622 ACAACATACCATGGGCTGTGAGG + Intergenic
1056932256 9:90889008-90889030 CCTGATTACCATGAGCAGTGAGG + Intronic
1057785548 9:98084892-98084914 ACTACCTACCAAGTGCTGTGAGG - Exonic
1061873646 9:133533536-133533558 CCTACGGGCCCAGAGCTGTGAGG - Intronic
1186691798 X:11985550-11985572 CATAGGTACCAGGCGCTGTGAGG + Intergenic
1189688842 X:43594200-43594222 CCTACTTCCCATGACCTATGAGG - Intergenic
1190431276 X:50379854-50379876 CCTTCCTCCCATGAGCTGTGAGG + Intronic
1197018320 X:121654914-121654936 CATACGTATCATGAGTTGTCAGG + Intergenic
1199852891 X:151737954-151737976 CCTAAGGAGCATGAGCTCTGAGG - Intergenic