ID: 966976379

View in Genome Browser
Species Human (GRCh38)
Location 3:185087106-185087128
Sequence CAAGGATTGAAACGGGTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966976379 Original CRISPR CAAGGATTGAAACGGGTTTC TGG Intronic
901656317 1:10771833-10771855 CAAGGCTGGAAGCGGGTTCCAGG - Intronic
905140019 1:35835914-35835936 CAAAGATTGGAAAGGGTTTGAGG - Exonic
908385366 1:63636230-63636252 CAAGGATCGAAACATGATTCTGG + Exonic
908941567 1:69441130-69441152 CAAGGAGTGCCAAGGGTTTCTGG - Intergenic
915146156 1:153796763-153796785 CAAGGATTGTCAGGGGCTTCTGG + Intergenic
915349763 1:155216975-155216997 CAAGGAGTGAAACGGGACGCTGG + Intergenic
915353022 1:155238252-155238274 CAAGGAGTGAAACGGGACGCTGG + Exonic
918826637 1:189332480-189332502 CAAGGATTGAGACTAGATTCTGG + Intergenic
920983355 1:210859711-210859733 CAAGGTTTAAATCAGGTTTCTGG - Intronic
1072811683 10:98467383-98467405 CCTGGACTAAAACGGGTTTCTGG - Intronic
1079460183 11:20671495-20671517 CACGGAATGGAACGTGTTTCAGG + Intronic
1080728348 11:34919238-34919260 CAAGGATTGCCACGTGTTTTCGG - Intronic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1097122957 12:56750050-56750072 CAAGTATAGAAATGGGTTTTAGG + Intronic
1105915867 13:24915277-24915299 GGAGGATTGAAACAGGTTTTGGG + Intronic
1110781246 13:79467569-79467591 AAAGGATTGAAACAAATTTCTGG - Intergenic
1112139489 13:96622557-96622579 CAAGGAATAGAAAGGGTTTCAGG + Intronic
1119021490 14:71119889-71119911 CAAGGACTGAAATAGGCTTCAGG + Intergenic
1130244902 15:82237986-82238008 CAAGGGTTAAAAAGGGTTTGAGG + Intronic
1133294894 16:4746901-4746923 CAGGGAGAGAAATGGGTTTCTGG - Intronic
1138495156 16:57404340-57404362 CAGGGATTGATGCTGGTTTCTGG + Intergenic
1138909359 16:61377718-61377740 CAAGGAATGACAAGGATTTCTGG - Intergenic
1145091514 17:19990065-19990087 CAAGGATTGAAAAATGGTTCTGG + Intergenic
1150897546 17:69231174-69231196 CAAGGAATGACAAGGGTTGCTGG - Intronic
1152041587 17:77907074-77907096 CAAGGGAAGAAACAGGTTTCTGG - Intergenic
1155281555 18:24245862-24245884 GAAGGACTGAAAAAGGTTTCAGG - Intronic
1155581409 18:27312275-27312297 CAAGGAATGACAAGGGTTCCTGG - Intergenic
1156548315 18:37987937-37987959 CTAGGATTGCAACTGGTCTCAGG - Intergenic
1157708878 18:49834299-49834321 CAAGGATTAAAAAGGGGTTCAGG - Intronic
1159917427 18:74199407-74199429 CAAGGATAAAAACGAGTTACTGG + Intergenic
929388051 2:41434778-41434800 CAGTGATTGAAACTGTTTTCTGG - Intergenic
935454788 2:103254698-103254720 CAAGTATTCAAAGGGCTTTCAGG + Intergenic
936806446 2:116338150-116338172 CAAGGATTAAAACCAGTTTAAGG - Intergenic
940252539 2:151695118-151695140 GAAGGATAGAAATGGGTATCTGG + Intronic
947516735 2:230812203-230812225 CAAGGAGAGAAACCGGTTTCAGG - Intronic
1169254226 20:4085120-4085142 GAAGGATTGCAATGGGTTTGGGG + Intergenic
1169576380 20:6966535-6966557 CAAGGAATGACAAGGGTTGCAGG + Intergenic
1173487559 20:43452642-43452664 CTAGGAGTGGAAAGGGTTTCAGG - Intergenic
1177569836 21:22872855-22872877 CAAGTATTTAAATGTGTTTCTGG - Intergenic
1179176308 21:39010627-39010649 CAAGGATTGAAACTGGGAGCGGG - Intergenic
1182956766 22:34434057-34434079 CAAGGTTAGAACCAGGTTTCAGG + Intergenic
949350017 3:3115962-3115984 AAAGGATTGAAACAGAATTCTGG + Intronic
949940674 3:9151926-9151948 CAAGGATAGAACCGGGTTCCTGG + Intronic
952046343 3:29325985-29326007 CAAGGATGGAAAGGTGATTCAGG - Intronic
953205798 3:40827809-40827831 CCAGGATTGAAACTCGGTTCAGG + Intergenic
958908634 3:99968988-99969010 AAAAGATTTAAATGGGTTTCTGG + Intronic
961341564 3:126225932-126225954 CAAGGATTTTAAAGGGTTTCTGG - Intergenic
962084153 3:132173257-132173279 CCAGGATTGCAAAGGGTTTGTGG - Intronic
966976379 3:185087106-185087128 CAAGGATTGAAACGGGTTTCTGG + Intronic
971238507 4:24865845-24865867 CAAGGATTGAAAGGGCTTATGGG + Intronic
975663232 4:76708042-76708064 CAAGAATCAAAATGGGTTTCAGG + Intronic
982997450 4:162367543-162367565 CAATGATTGAAAAGGACTTCAGG - Intergenic
983313612 4:166097868-166097890 CAAGGATTGAAAGAGTTTCCGGG - Intronic
984574471 4:181431338-181431360 CTAGGGTTGAAATGAGTTTCTGG - Intergenic
985335054 4:188883405-188883427 CAAGGAATGACAAGGGTTGCCGG - Intergenic
986424969 5:7622358-7622380 CAAGGATGAAACCGGGTATCAGG + Intronic
986425678 5:7629099-7629121 CAATGACTGAAACTGTTTTCTGG - Intronic
997030992 5:130127736-130127758 TAAGGATTAAAACCTGTTTCTGG + Intronic
1003377543 6:5593658-5593680 CAAGGATTCAAAGTGGTTTGCGG - Intronic
1008358797 6:50589897-50589919 CAAGGAATGAGAAGGATTTCTGG + Intergenic
1012260763 6:97084858-97084880 AAAGGAGTGAAAGGGGTCTCTGG - Intronic
1014461143 6:121697258-121697280 GAAGGAATGAGACAGGTTTCAGG + Intergenic
1018961068 6:168448792-168448814 CAAGGATGGAAACGTGTTGTTGG + Intronic
1028420168 7:90623935-90623957 CAAGCATGAAAAGGGGTTTCAGG - Intronic
1031895899 7:127347710-127347732 CAAGGGGTGAAAGGGGTTTGAGG + Intronic
1032357883 7:131227132-131227154 CAGGGAAAGAAACGGGTTACAGG - Intronic
1040378151 8:46846368-46846390 GAAGGATTGTAACATGTTTCTGG + Intergenic
1044180601 8:89189144-89189166 CAATGATTCAAACAGGTTTGGGG + Intergenic
1044519873 8:93187194-93187216 CATGGATTTAAAAAGGTTTCTGG + Intergenic
1049618790 8:143588606-143588628 GAAGCATTGAAGCTGGTTTCTGG - Intronic
1185777431 X:2815666-2815688 CAAGAATTGAAAAGTGTTGCAGG - Intronic
1189602161 X:42638780-42638802 CAAATATTGAAACAGGTTTCTGG - Intergenic
1196770847 X:119291838-119291860 CCAGGTTTGAAAAGGCTTTCTGG + Intergenic
1198261428 X:134968412-134968434 TAAGGATGGAAGTGGGTTTCAGG - Intergenic
1199587676 X:149433281-149433303 CAAGGAGTGAAAAGGCTATCTGG + Intergenic
1199612546 X:149631021-149631043 CAAGGATTCAACAGTGTTTCAGG + Intronic
1200870532 Y:8093407-8093429 GAAGGATTGTAACAGATTTCTGG - Intergenic
1200890054 Y:8313668-8313690 GAAGGATTGTAACAGATTTCTGG + Intergenic
1201292553 Y:12435477-12435499 CAAGAATTGAAAAGTGTTGCAGG + Intergenic
1201513529 Y:14791655-14791677 CAAGGGTTAGGACGGGTTTCAGG - Intronic