ID: 966978581

View in Genome Browser
Species Human (GRCh38)
Location 3:185108578-185108600
Sequence GGCCAATCGCCTAGTTGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 22}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966978579_966978581 0 Left 966978579 3:185108555-185108577 CCTTTGACTGAAGGGAATCAAAT 0: 31
1: 52
2: 33
3: 32
4: 185
Right 966978581 3:185108578-185108600 GGCCAATCGCCTAGTTGCTAAGG 0: 1
1: 0
2: 0
3: 2
4: 22
966978578_966978581 6 Left 966978578 3:185108549-185108571 CCAGGACCTTTGACTGAAGGGAA 0: 28
1: 60
2: 36
3: 21
4: 181
Right 966978581 3:185108578-185108600 GGCCAATCGCCTAGTTGCTAAGG 0: 1
1: 0
2: 0
3: 2
4: 22
966978575_966978581 16 Left 966978575 3:185108539-185108561 CCTCTTTCTTCCAGGACCTTTGA 0: 1
1: 0
2: 3
3: 38
4: 415
Right 966978581 3:185108578-185108600 GGCCAATCGCCTAGTTGCTAAGG 0: 1
1: 0
2: 0
3: 2
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966978581 Original CRISPR GGCCAATCGCCTAGTTGCTA AGG Intronic
903070613 1:20725342-20725364 TGCCAAGCGCCTAGCTGCCAAGG + Intronic
911841339 1:102686222-102686244 GGCCAAGCGCCCATTTGCTAAGG + Intergenic
1086135320 11:83438549-83438571 GGCCAATCCCCAAGTTCTTATGG + Intergenic
1093977406 12:25438321-25438343 GGCCAATGGCCTAGTTGTGCAGG - Intronic
1106846283 13:33741277-33741299 GGCCTTTCCCCTAGTTTCTAGGG + Intergenic
1115137940 14:30133405-30133427 GGCCAGTAGGCTACTTGCTAGGG - Intronic
1118824006 14:69363926-69363948 GGCCAGTCACCCAGTGGCTAGGG - Intergenic
1137014993 16:35365719-35365741 GGCCAATCACCTAGGTGTTGGGG - Intergenic
1148899936 17:50867528-50867550 AGCCAATCGCCTCGTTGCGAAGG - Intronic
927106214 2:19829630-19829652 GGCCAAAAGCCTAATTGATAAGG + Intergenic
927483168 2:23470180-23470202 GGCCCATCTCCTAGTTGCCTTGG - Intronic
949420476 3:3859919-3859941 GGCAAATTGCCTATTGGCTATGG + Intronic
950850711 3:16059772-16059794 GGCCAATCCTGAAGTTGCTATGG - Intergenic
952938888 3:38424895-38424917 TGCTGATTGCCTAGTTGCTATGG + Intergenic
966978581 3:185108578-185108600 GGCCAATCGCCTAGTTGCTAAGG + Intronic
982074761 4:151727399-151727421 GGCCAATGGCCCAACTGCTACGG + Intronic
996584423 5:125068913-125068935 GGCAAACAGGCTAGTTGCTATGG + Intergenic
1001422487 5:171598457-171598479 GGACAATCCCCTAGTCTCTAGGG + Intergenic
1016381734 6:143491010-143491032 GGCCAACCGCAAAGTTGCTCTGG - Intergenic
1036227386 8:6971163-6971185 GGACAATTGCCTCGTTGCTTGGG + Intergenic
1052419098 9:28218859-28218881 GGCAAATGGGCTATTTGCTATGG - Intronic
1055570205 9:77608789-77608811 GGGCCATCGCCAAGGTGCTATGG - Intronic
1060120740 9:120987239-120987261 GGCCATTGGCCTAGATGTTATGG + Intronic
1199761147 X:150905059-150905081 CACCAATCTCCCAGTTGCTAGGG + Intergenic
1200896487 Y:8381362-8381384 GACAAATCACCTAGTTGATAGGG + Intergenic