ID: 966982219

View in Genome Browser
Species Human (GRCh38)
Location 3:185148260-185148282
Sequence CCTCACATGGTGATGTCGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966982219 Original CRISPR CCTCACATGGTGATGTCGGT AGG (reversed) Intronic
901133793 1:6979832-6979854 CCTCTCATGGTGGTGTAGCTGGG + Intronic
909068002 1:70959761-70959783 CCTGACATGATGTTGTCTGTGGG - Intronic
917444750 1:175097814-175097836 GCTCTCGTGGTGATGGCGGTGGG + Intronic
921025910 1:211281546-211281568 CCTTACATGGTGTCGTCTGTAGG + Intronic
922516313 1:226210722-226210744 CCCCAGAGGGTGATGCCGGTGGG - Intergenic
922527228 1:226313644-226313666 CCTCACATTGTGATCTAGGTAGG - Intergenic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
1070068604 10:73063316-73063338 CCTCACATGGTGAAGGCTGAAGG + Intronic
1070318400 10:75335748-75335770 CCTTCCATGGTGGTGTGGGTGGG + Intergenic
1070551606 10:77494787-77494809 TCTGACATGGAGATGTCGTTGGG + Intronic
1071759101 10:88580151-88580173 GCTCACATGATTATGTTGGTTGG - Intronic
1075446959 10:122519727-122519749 CCTCACATGTTGACCTCGGAAGG + Intergenic
1075556307 10:123435003-123435025 CCTCACGTGGGGAGGTAGGTTGG - Intergenic
1076005497 10:126945271-126945293 GCTCACATGGTGGTGTTGGCAGG + Intronic
1078961444 11:16277308-16277330 CCTCACATGGTGGAGTGGGTGGG - Intronic
1079041390 11:17063538-17063560 CCTCCCATGGGGATGTCACTGGG - Intergenic
1087268119 11:96083127-96083149 CTTGACATTCTGATGTCGGTAGG + Intronic
1089015450 11:115161636-115161658 CAGCACATGGTGATGGAGGTGGG + Intergenic
1090172827 11:124619626-124619648 CCTCACACGGCTATGTCGGTGGG + Exonic
1090686911 11:129131727-129131749 ACTCACCTGGTGATGTGGTTTGG - Intronic
1092779076 12:11968697-11968719 CCTCCCATGGTGGTGGAGGTGGG + Intergenic
1096212841 12:49779606-49779628 CTTCACATGGTGATATGGTTTGG + Intergenic
1101207926 12:102507430-102507452 CCTCACAGGGTGATATGGTTTGG + Intergenic
1107490438 13:40876139-40876161 CCTCGCATTGTGCTGTCGGCAGG + Intergenic
1108038451 13:46316510-46316532 CCTCACATGGTGATATAAATGGG + Intergenic
1108137083 13:47376564-47376586 CCTAACATGGTGATAACAGTGGG - Intergenic
1108677597 13:52750680-52750702 CCTCACATGGTGGAGAGGGTGGG - Intergenic
1110274970 13:73632881-73632903 CCTCACATGGTGTTGTGGGTCGG + Intergenic
1113884530 13:113651759-113651781 CCTCACATGGCGGTGGGGGTGGG - Intronic
1118179618 14:63479278-63479300 TCTCCCATGGTGCTGTGGGTGGG + Intronic
1119628798 14:76207981-76208003 CCTCAGATGCTCATGTCTGTAGG + Exonic
1119959982 14:78844178-78844200 CCTCACATGGTGTTTGCTGTGGG + Intronic
1123123846 14:105930438-105930460 CCTCCCCTGGGGATGACGGTTGG + Intronic
1126540408 15:49816386-49816408 CTCCACATGGTGATGTCTGTGGG + Intergenic
1127578400 15:60314537-60314559 TCTCACATGGTGATATGGTTTGG - Intergenic
1127935007 15:63628671-63628693 CCTCACCTGGTGCTCTTGGTGGG + Exonic
1129042388 15:72700399-72700421 CCTCACACGTTGCTGGCGGTCGG - Intronic
1132236602 15:100226688-100226710 CCTCAGAGGATGATCTCGGTTGG + Intronic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1147479808 17:40749502-40749524 CCTCACTTAGTGATGTCACTTGG - Intronic
1150776450 17:68085527-68085549 ATTCCCATGGTGTTGTCGGTGGG - Intergenic
1151429912 17:74055496-74055518 CCTCACATGGTGGGGTGGGGTGG - Intergenic
1152283759 17:79400581-79400603 CCTCACAAGGTGTTGGGGGTGGG + Intronic
1152600612 17:81260378-81260400 CCTCAGGTGGTGCTGTGGGTCGG - Exonic
1167800151 19:51735388-51735410 CCTCACATGGTGGTGGGGGCAGG + Intergenic
1167942662 19:52960177-52960199 CCTCGCATTGTGCTGTCGGCAGG - Exonic
925033991 2:672357-672379 CCCCACATCCTGATGTCGGGGGG - Intronic
929323843 2:40581196-40581218 CCTTACATGGTGATATGGTTTGG - Intronic
931264904 2:60652073-60652095 CTCCACATGGTCATGTCTGTGGG + Intergenic
932350010 2:71024084-71024106 CCTCACATTATGCTGTCGGCAGG - Intergenic
933560551 2:83880320-83880342 CTTCACATGGAGGTGTGGGTTGG - Intergenic
933651438 2:84853198-84853220 CATCACATGGTGTTCTCGGTGGG - Intronic
937236420 2:120434096-120434118 CAACCCATGGTGATGTCGCTGGG + Intergenic
939856878 2:147368943-147368965 TGTCACATGGAGATGTAGGTAGG + Intergenic
944192442 2:197017952-197017974 ACTCACATGGAGATGTCATTAGG + Intronic
948053920 2:234997423-234997445 CCTCTGATGGTGATGACAGTGGG - Intronic
1171408596 20:24930657-24930679 CCTCACATTATGCTGTCGGCAGG - Intergenic
1171986751 20:31666121-31666143 CCTCAGAGAGTGATGTAGGTGGG + Intronic
1178808813 21:35862122-35862144 CCTTACAGGGTAATGTTGGTGGG - Intronic
1179633283 21:42691796-42691818 CCTCAAATGGTGATGATGATGGG - Intronic
1180258007 21:46646935-46646957 CCTCACGTGGTGAAGGCGGGAGG + Intronic
1184422669 22:44391023-44391045 CCTCAGAAGGGGATGTGGGTTGG - Intergenic
949303273 3:2609305-2609327 CCTCACATGGTGAAGGCAGAAGG - Intronic
952825255 3:37519311-37519333 TCTATCATGGTGATGCCGGTGGG + Exonic
953930102 3:47001646-47001668 CCTCCCCTGGTGATGTCTGTTGG + Intronic
957032955 3:75264503-75264525 CCTCACAAGGTGATATGGTTTGG + Intergenic
957044326 3:75362239-75362261 CCTCACATCATGCTGTCGGCAGG + Intergenic
963291651 3:143496367-143496389 CCTAACATGGTGATTTATGTAGG - Intronic
966780407 3:183579630-183579652 CCTGACATGGTAATGGGGGTGGG - Intergenic
966982219 3:185148260-185148282 CCTCACATGGTGATGTCGGTAGG - Intronic
972297785 4:37756773-37756795 CCTTACATGGTGATATGGTTTGG + Intergenic
974620574 4:64348378-64348400 CCTCACATGTTGAGGGCGGGAGG - Intronic
975805082 4:78103692-78103714 CCTCACATGGTGAAAGGGGTTGG - Intronic
976594346 4:86880525-86880547 CCACACATAGTGTTGTTGGTTGG - Intronic
981330327 4:143501005-143501027 ACTCACATGGTGATATGGTTTGG + Intergenic
984632247 4:182073383-182073405 CCTCACATAGTGATATGGTTTGG - Intergenic
985919818 5:2961469-2961491 CCTCCCATGATGATGTGGTTCGG - Intergenic
988393694 5:30669258-30669280 CTTCACATGGTGGTGTCAGTAGG - Intergenic
995013802 5:107287845-107287867 CCTCACCTGGTGCTGACTGTAGG - Intergenic
995728032 5:115202922-115202944 CCCGAAAGGGTGATGTCGGTGGG + Intergenic
1000132813 5:158316235-158316257 TCTTACATGGAGATGTTGGTTGG + Intergenic
1004622266 6:17341499-17341521 CCTCTCATAATGATGTTGGTTGG + Intergenic
1010147021 6:72682162-72682184 CCTCACATGGTTATGTTCTTTGG + Intronic
1010973817 6:82290993-82291015 TCTCAAATGGTGATATGGGTTGG - Intergenic
1017336035 6:153261375-153261397 CCACACATGGTGATATGGTTTGG + Intergenic
1017631801 6:156403259-156403281 CATCACATGGTGATATAGTTTGG + Intergenic
1018832160 6:167451458-167451480 CCTCACCCTGTGAGGTCGGTGGG - Intergenic
1019557381 7:1639423-1639445 CCTCGCTAGGGGATGTCGGTGGG + Intergenic
1024241991 7:47442848-47442870 CCTCTGATGGTGGTGTCTGTGGG - Intronic
1028555495 7:92119169-92119191 CCTGAGATGGTGATATCAGTTGG + Intronic
1032139118 7:129310428-129310450 CCTCAAATGTTGATGTCCATTGG - Intronic
1032742045 7:134748938-134748960 CCTCACATGGTGAAAGGGGTGGG - Intronic
1039583379 8:38685154-38685176 CCTGGCATGGTGATGTCTGGGGG - Intergenic
1041156447 8:54992147-54992169 CCTCACATGGTGGTTGGGGTGGG + Intergenic
1041872540 8:62651628-62651650 TCTCACATGGTGATATGGTTTGG + Intronic
1042045567 8:64647509-64647531 CCTCACGTGGTTATGAAGGTTGG + Intronic
1047622785 8:126624668-126624690 GCTCACATGGTGTTTTCAGTAGG + Intergenic
1048886749 8:138915119-138915141 CCTGACATGGTGAGGGTGGTGGG - Intergenic
1049270533 8:141693329-141693351 CCCCTCATGGTGATGACAGTAGG - Intergenic
1058109575 9:101017708-101017730 CCTCACATGGTGAAGGCAGAAGG + Intergenic
1185938702 X:4288777-4288799 CCTCACTTGGTGATGTGGTTTGG + Intergenic
1187708405 X:22029941-22029963 CCTCACATGCTAATGTCTGCGGG - Intergenic
1196215909 X:113051067-113051089 CCTGTGATGGTGGTGTCGGTGGG + Intergenic
1199272846 X:145905304-145905326 CCACACATGTTCATGTTGGTTGG - Intergenic
1200925357 Y:8649468-8649490 CCTCACATTGTGCTGTTGGCAGG - Intergenic