ID: 966982660

View in Genome Browser
Species Human (GRCh38)
Location 3:185152791-185152813
Sequence CGGCCTCGCCGGCGTCGGAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 79}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966982660_966982670 19 Left 966982660 3:185152791-185152813 CCGCTCCGACGCCGGCGAGGCCG 0: 1
1: 0
2: 0
3: 6
4: 79
Right 966982670 3:185152833-185152855 CTCCGCGCGGAGCCGACACCGGG 0: 1
1: 0
2: 0
3: 3
4: 75
966982660_966982673 27 Left 966982660 3:185152791-185152813 CCGCTCCGACGCCGGCGAGGCCG 0: 1
1: 0
2: 0
3: 6
4: 79
Right 966982673 3:185152841-185152863 GGAGCCGACACCGGGAGCCCGGG 0: 1
1: 0
2: 2
3: 34
4: 167
966982660_966982672 26 Left 966982660 3:185152791-185152813 CCGCTCCGACGCCGGCGAGGCCG 0: 1
1: 0
2: 0
3: 6
4: 79
Right 966982672 3:185152840-185152862 CGGAGCCGACACCGGGAGCCCGG 0: 1
1: 0
2: 0
3: 14
4: 163
966982660_966982669 18 Left 966982660 3:185152791-185152813 CCGCTCCGACGCCGGCGAGGCCG 0: 1
1: 0
2: 0
3: 6
4: 79
Right 966982669 3:185152832-185152854 CCTCCGCGCGGAGCCGACACCGG 0: 1
1: 0
2: 2
3: 2
4: 60
966982660_966982665 6 Left 966982660 3:185152791-185152813 CCGCTCCGACGCCGGCGAGGCCG 0: 1
1: 0
2: 0
3: 6
4: 79
Right 966982665 3:185152820-185152842 TCATTTCCTCTCCCTCCGCGCGG 0: 1
1: 0
2: 1
3: 10
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966982660 Original CRISPR CGGCCTCGCCGGCGTCGGAG CGG (reversed) Exonic
900318617 1:2071342-2071364 AGGCCCCGGCGGCGTCTGAGAGG + Intronic
900562355 1:3313606-3313628 CGGCCTCGCAGGCGCAGGTGAGG - Intronic
901188707 1:7390914-7390936 AGGCCTCGCCTCCGTTGGAGTGG + Intronic
903950611 1:26994029-26994051 GGGGCTCGCCGGCCCCGGAGGGG + Exonic
908131871 1:61082466-61082488 CGGCCGGGCCGGCGCGGGAGCGG + Intronic
914293581 1:146297978-146298000 CCGTCCCGCCCGCGTCGGAGCGG + Intergenic
914554625 1:148748761-148748783 CCGTCCCGCCCGCGTCGGAGCGG + Intergenic
919650758 1:200147211-200147233 CGGCCTCGCTGGCTTCAGCGAGG - Intronic
924952372 1:248896850-248896872 CGGCCTCCCTGGCCTGGGAGCGG - Intergenic
1063115173 10:3067652-3067674 TGGCCTTGCCGGCCCCGGAGAGG - Exonic
1065110807 10:22437811-22437833 CGGCATCGCCGGCCTGGGGGAGG + Intronic
1073123140 10:101133940-101133962 CGGCGACGGCGGCGTCGGACTGG + Intronic
1073217244 10:101843411-101843433 GGGCCAGGCCGGGGTCGGAGAGG + Intronic
1075119128 10:119651567-119651589 CGGACACGTCGGCGGCGGAGAGG + Exonic
1075522216 10:123149684-123149706 CGCCCTCGCCGGGGTCCGAGCGG + Exonic
1083933505 11:65858430-65858452 CCGCCTCGCCGGGCTCAGAGCGG - Exonic
1083992865 11:66257712-66257734 CTACCTCGGTGGCGTCGGAGGGG - Intronic
1084316368 11:68348088-68348110 CGGCCTCGCCTGCGACTGGGTGG + Exonic
1100309130 12:93378131-93378153 CCGTCCCGCCCGCGTCGGAGCGG + Exonic
1108227389 13:48303664-48303686 CGGGCCCGCCGGCGTCTGTGGGG - Intergenic
1108407938 13:50124078-50124100 CGGCCTCGCCCGCGTCCCTGGGG - Intronic
1117647367 14:57865997-57866019 CGGCGGCGGCGGCGGCGGAGCGG + Intronic
1119290510 14:73491505-73491527 CGGCCCCGACGCCGTCGCAGGGG - Exonic
1119325923 14:73759579-73759601 CGGCCTGGGCGGCGGTGGAGCGG - Intronic
1122602903 14:102930151-102930173 GGGCCTCGCCTGCGACGGAGGGG - Exonic
1123002034 14:105300910-105300932 GCGGCGCGCCGGCGTCGGAGGGG + Exonic
1123073150 14:105652047-105652069 CGGCCTCACCTGGGCCGGAGGGG - Intergenic
1123093073 14:105750817-105750839 CGGCCTCACCTGGGCCGGAGGGG - Intergenic
1125626837 15:41115992-41116014 CCGCCGCGACGGCGGCGGAGGGG + Exonic
1129711063 15:77820356-77820378 CGGGCTCCACGGCGGCGGAGAGG - Intronic
1131119664 15:89814522-89814544 GGGCCTCGCAGGGGTCGGAGGGG - Intronic
1133202463 16:4212634-4212656 TGGCCTGGCCGGAGTCGGGGGGG - Intronic
1137617264 16:49855507-49855529 CGGCGGCGGCGGCGGCGGAGGGG - Intronic
1142298211 16:89241004-89241026 GTGCCTCGCCGGCTTCGGGGTGG + Intergenic
1142341487 16:89525833-89525855 CAGCCTCGCCGGCCTCTGGGGGG + Intronic
1142611009 17:1109229-1109251 CGGCGGCGGCGGCGGCGGAGCGG - Intronic
1148664066 17:49361823-49361845 CGGCCCCGCGGGCGGCGGAGAGG + Intronic
1152697413 17:81804061-81804083 CGGCCCCGCGGGGGTGGGAGCGG - Intergenic
1154174505 18:12076626-12076648 CGGCCCCGCCGGCGTCCGGGCGG + Intergenic
1157867051 18:51196766-51196788 CGGCCGCGGCGGCGGCGGCGGGG - Exonic
1159798106 18:72867785-72867807 CGGCGGCGCCGGCGGCGGCGGGG + Exonic
1163294396 19:16403096-16403118 GGCCCTCGCCTGTGTCGGAGTGG - Intronic
1165922594 19:39308079-39308101 TGGCCTCGACGGCGACGGCGGGG + Exonic
1166995308 19:46717147-46717169 GGGCCTCGGCGACGTCAGAGAGG + Intergenic
1167601838 19:50459224-50459246 CGTACTCCCCGGAGTCGGAGCGG - Exonic
926801798 2:16665807-16665829 CGTACTCGGCGGCGGCGGAGCGG - Exonic
930817823 2:55617383-55617405 CGGCGGCGGCGGCTTCGGAGAGG + Exonic
938318021 2:130343204-130343226 CGGCCCCGCGGGCGTCTGCGTGG + Intronic
938369932 2:130762593-130762615 TGGCCTCGCTGGCGGCCGAGGGG + Exonic
941772931 2:169362989-169363011 CCGCCTCGCCGGCTTCTGTGCGG - Intergenic
942045865 2:172099137-172099159 CGGTGGCGCCGGCGCCGGAGGGG + Intergenic
945648936 2:212537138-212537160 CGGCGGCGGCGGCGGCGGAGCGG + Intronic
1172843116 20:37913897-37913919 CGGCCAGGTTGGCGTCGGAGTGG + Intronic
1176194616 20:63831408-63831430 CGGCCGGGCCGGCGTGGGCGGGG - Intergenic
1179674888 21:42974681-42974703 CGGCGGCGGCGGCGGCGGAGCGG - Intronic
1180843560 22:18970217-18970239 CGGCCCTGCAGGCGGCGGAGGGG - Intergenic
1184228269 22:43143181-43143203 CGCCCTGGGCGGCGACGGAGCGG - Exonic
950316336 3:12004709-12004731 CCGCCTCGCCGGGCCCGGAGCGG + Exonic
950888092 3:16378179-16378201 CAGCCTCGCAGGCCTCGGGGAGG - Intronic
961682540 3:128608556-128608578 CGGCCTCGCAGGCGTGGGGCAGG + Intergenic
966886681 3:184380844-184380866 GGGTCGCGCGGGCGTCGGAGTGG + Intronic
966982660 3:185152791-185152813 CGGCCTCGCCGGCGTCGGAGCGG - Exonic
968035237 3:195542999-195543021 CGGCCTCGACGGCCTCGCACCGG - Exonic
968234572 3:197024122-197024144 CGGCGGCGCCGGCGGCAGAGTGG + Intronic
971018962 4:22515756-22515778 CGGCCCCGCCGGCGTCCGGGTGG + Exonic
977257549 4:94757921-94757943 CGGCGGCGGCGGCGGCGGAGCGG + Intergenic
977810017 4:101347291-101347313 TGGCGTCCCCGGCGGCGGAGAGG + Exonic
977810066 4:101347530-101347552 CGGCGGCGGCGGCGGCGGAGGGG - Intronic
987258268 5:16179474-16179496 CGGCGTCGGCGGCGGCGGCGGGG + Exonic
990581766 5:57173291-57173313 CTGCCGAGCCGGCGCCGGAGCGG - Intergenic
998943385 5:147310514-147310536 AGGCCTGGCTGGCGTGGGAGAGG - Intronic
1004220608 6:13743314-13743336 CGGCCCCGCCGGGGTGTGAGGGG + Intergenic
1006125470 6:31835045-31835067 CGGCCTGGCTGGGGTAGGAGAGG + Exonic
1013803299 6:113970829-113970851 CGGCCGGGCCGGTGTCGGGGTGG - Intronic
1023049162 7:36236234-36236256 CGGCCTCGCCAGCCCCAGAGAGG - Intronic
1023581589 7:41689999-41690021 CCTCATCGCCGGCGTCGGCGGGG - Exonic
1036398227 8:8386484-8386506 CGGCGTCACCGGAGGCGGAGGGG - Exonic
1042532859 8:69832990-69833012 CGGCGGCGGCGGCGGCGGAGGGG - Exonic
1050455802 9:5832935-5832957 CGGCCGCGCCACCGCCGGAGAGG - Exonic
1051667639 9:19480505-19480527 CAGCCTCGCCAGAGTGGGAGAGG - Intergenic
1059145546 9:111896672-111896694 CGCTCTCGCCGGCGCCGCAGCGG + Intergenic
1060770175 9:126326816-126326838 CGGCGGCGGCGGCGGCGGAGGGG - Intergenic
1061859239 9:133459752-133459774 GGGGCTCGCAGGCATCGGAGAGG - Intergenic
1062656338 9:137605970-137605992 CGGGCTCGGCGGCGCCGGGGAGG + Intronic
1188811334 X:34657049-34657071 CGTCCTCGCCTGCGGCGGGGCGG - Exonic
1196925547 X:120630143-120630165 CGCCCGCGCAGGCGTCGGAAGGG + Exonic