ID: 966982727

View in Genome Browser
Species Human (GRCh38)
Location 3:185153030-185153052
Sequence GCGCGCGCCGCGCCGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 259}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966982727_966982737 22 Left 966982727 3:185153030-185153052 CCTCCCTCCGGCGCGGCGCGCGC 0: 1
1: 0
2: 1
3: 21
4: 259
Right 966982737 3:185153075-185153097 GCGCACAGGCGCGCGCCGGTCGG 0: 1
1: 0
2: 0
3: 5
4: 78
966982727_966982735 8 Left 966982727 3:185153030-185153052 CCTCCCTCCGGCGCGGCGCGCGC 0: 1
1: 0
2: 1
3: 21
4: 259
Right 966982735 3:185153061-185153083 ACGCGCACACGCACGCGCACAGG 0: 1
1: 0
2: 6
3: 34
4: 295
966982727_966982736 18 Left 966982727 3:185153030-185153052 CCTCCCTCCGGCGCGGCGCGCGC 0: 1
1: 0
2: 1
3: 21
4: 259
Right 966982736 3:185153071-185153093 GCACGCGCACAGGCGCGCGCCGG 0: 1
1: 0
2: 0
3: 21
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966982727 Original CRISPR GCGCGCGCCGCGCCGGAGGG AGG (reversed) Intergenic
900113754 1:1020123-1020145 GCGCGGGCCGCGCCGGGGACGGG - Exonic
900240636 1:1615792-1615814 GCGCGCGCAGCGCCGCCGCGGGG + Intronic
900393461 1:2443689-2443711 GCCCGCCCCGCGCCGGGAGGGGG - Intronic
901242735 1:7704523-7704545 GCCCGAGCCGCGCTGGACGGCGG - Intronic
901730111 1:11273164-11273186 GCGCGGGCTGGACCGGAGGGTGG - Intergenic
902770086 1:18640827-18640849 GGGCGCGCCGGGCCGGGGGCTGG + Intronic
903190145 1:21651833-21651855 GCGCGGGCCGGGCCGGGCGGCGG - Exonic
903353560 1:22732379-22732401 GCGCGTGGGGGGCCGGAGGGCGG + Intronic
903813259 1:26046376-26046398 GCGCACCCCGCGCGGGAGAGGGG - Intergenic
903935083 1:26889976-26889998 GCGCGCGCTGGGCCGGCGCGTGG - Exonic
904006658 1:27366560-27366582 GCGCGCTCCGCCCCGGACCGGGG + Exonic
904528849 1:31155135-31155157 GCGGGCGCGGGGCCGGAGGTGGG + Intergenic
904751242 1:32742264-32742286 GCGCGCGGCGTGTTGGAGGGGGG + Intronic
905066843 1:35192088-35192110 GCGCGCGCCGCTGCGGGGGCGGG - Intronic
906004442 1:42456655-42456677 GGGCGCGCAGGGCCGGCGGGTGG + Exonic
906130691 1:43453627-43453649 GCGCGCGCCGCGCGAGAAGCGGG - Exonic
906641695 1:47444805-47444827 GGGCGCGGCGCGGCGCAGGGCGG + Intergenic
906726671 1:48049218-48049240 GCTCGCGCAGCTCCGGATGGAGG - Intergenic
907341518 1:53739072-53739094 GCGCGGCCCGCGGCCGAGGGAGG - Intergenic
909075617 1:71047640-71047662 GCGCGGGCGGCGGCGGAGGTCGG + Exonic
910981243 1:92961546-92961568 GCGCGCGCCGCGGCGGGGGCGGG - Intergenic
911144704 1:94541484-94541506 GCGCGCCACACGCAGGAGGGAGG - Intronic
912492712 1:110070729-110070751 GCGCGCGCCGCGGGGGGCGGGGG + Intronic
912576260 1:110675001-110675023 GCGCGCGCCCCGCAGGGGAGGGG - Exonic
914869121 1:151458817-151458839 GCGCGCGCCGCGGCGGGCGCCGG + Intronic
915161261 1:153922520-153922542 GGGCGCGCCGTGCCGGGGTGGGG + Intronic
915325246 1:155078720-155078742 GCGCGCGACGCGTGGGAGGTGGG - Intergenic
916497244 1:165356734-165356756 GCGTGCGCGGCGGCGGAGAGGGG + Intergenic
916588250 1:166166469-166166491 CCGCGCGCCCTGCCGGAGCGAGG - Exonic
917329676 1:173868478-173868500 GAGCGCGCTGCGGCGGAGGGCGG - Intronic
917565340 1:176207077-176207099 ACGCCCGCCGAGCCGGAGGTGGG + Exonic
917846731 1:179026134-179026156 CCGCCCGCCGCGCCGGGGGCGGG - Intronic
920912675 1:210233028-210233050 GCGCGGGCCGCGGGGGCGGGAGG + Intronic
921023739 1:211259317-211259339 GGGCGGGCGGCGGCGGAGGGAGG + Intronic
922502929 1:226110217-226110239 GCGTGGGCCGCGGCGGAGGCCGG + Intergenic
922612447 1:226940409-226940431 GCACGCGGCGGGCCGGCGGGTGG - Intronic
922851166 1:228735336-228735358 GCGCGCGGCGCGCAGGCGGGGGG + Exonic
923506376 1:234609556-234609578 GCGCGCGTGGTGCCGGTGGGGGG - Intergenic
924090101 1:240492919-240492941 GCGCGCGCCCGGCCGCTGGGTGG - Exonic
1065845135 10:29737041-29737063 GCGCGCGCCGAGGGGGTGGGTGG - Intergenic
1066370524 10:34815214-34815236 GCGGGCGCCGCGGCGGGGAGAGG - Exonic
1069998036 10:72354954-72354976 GCCCGCGACGCGCCGGCGGGTGG - Exonic
1072591671 10:96832875-96832897 GCGCGCCCCGCGCGTGGGGGAGG - Intronic
1073812297 10:107164461-107164483 GCGCGCTCCTCGCCGGCGCGGGG - Exonic
1074801495 10:117005212-117005234 GCGCGCTCCGCGCCAGGAGGAGG - Exonic
1077040498 11:518994-519016 GCGCGCGAGGCGCCGCACGGGGG + Intergenic
1077076949 11:706267-706289 GAGCGCGGGGCGCCGGAGGCAGG + Exonic
1078729973 11:13964720-13964742 GAGCGAGCCGCGCCGACGGGCGG + Intronic
1079035095 11:17014102-17014124 GTGGGCGCCGGGCCGGCGGGTGG - Intronic
1080606634 11:33869626-33869648 GGGCGCGCCGCGGCCGAGGCGGG + Intronic
1081528279 11:43942078-43942100 GCGCGCGCGCCTGCGGAGGGGGG + Intronic
1083967581 11:66052087-66052109 GCCGGCGGCGGGCCGGAGGGCGG - Intronic
1088823523 11:113475426-113475448 GCGCGGGGAGCGCGGGAGGGAGG + Intronic
1089520024 11:119057178-119057200 GCGCGCGCCGCGTCCGGGGCCGG - Intronic
1090190283 11:124762368-124762390 GCGCGCCCCGCCCGGGAGGACGG - Intergenic
1091434113 12:460218-460240 GCCCGAGCCCCGCCGGAGAGCGG + Intergenic
1091550096 12:1530417-1530439 GCGCGCCCTGCTCCGGAGCGCGG - Intronic
1091718419 12:2795545-2795567 GCGCGCGGGGCGGCGGAGAGGGG + Intronic
1093675995 12:21941369-21941391 CCGCGCGCCGCGCCTGGGGCCGG + Intronic
1094025847 12:25958981-25959003 GCGCGCCCCGCACCGGCTGGAGG - Intergenic
1096127671 12:49131476-49131498 GGGCGCGCGGGGCCGGAGGAGGG - Intergenic
1096674923 12:53221212-53221234 GCCCGGGCCGCGGCGGAGGGCGG - Intronic
1098255379 12:68610841-68610863 CCGCGCGCCCCGCCCGCGGGCGG + Exonic
1100869410 12:98894901-98894923 GCACGCGCCGCGCGGGGGGCGGG - Intronic
1101772057 12:107760925-107760947 GCGCGGGCCCGGCCGGAGCGGGG - Intronic
1103309056 12:119989806-119989828 GCGCGCGCCAGGCTGCAGGGGGG - Intergenic
1103604791 12:122078725-122078747 GCGCGCGGCGCGGCGGGAGGGGG - Exonic
1105454279 13:20525894-20525916 GCGCGCGCGGACCGGGAGGGCGG + Intergenic
1106602665 13:31200586-31200608 GCGCGGGGCGCGCAGGACGGCGG - Intronic
1107468026 13:40666651-40666673 GCGCGCGCCGCCGCGGGCGGGGG - Intergenic
1110219651 13:73059495-73059517 GCGCGGGCTGCGCCTGCGGGCGG - Exonic
1113465550 13:110510254-110510276 GCGAGCGCCACGTGGGAGGGAGG + Intronic
1113895046 13:113759089-113759111 GCGGGCGCAGCGGGGGAGGGAGG + Intergenic
1114259100 14:21024966-21024988 GCGCCAGCCGGGCCGGCGGGCGG - Intronic
1116849450 14:49893431-49893453 GCTCGCGCGGCGCCTGCGGGGGG + Exonic
1118749026 14:68793387-68793409 GCCCGCGCGGCCCCGGAGAGGGG - Intronic
1118930161 14:70234161-70234183 GAGCGGGCCGCGCCGGGCGGCGG + Intergenic
1119646596 14:76352975-76352997 GCGCGCGGCCCGCAGGAGCGCGG - Intronic
1122208460 14:100159918-100159940 GGGCGCGCAGAGCCGGTGGGAGG - Exonic
1122220978 14:100239072-100239094 GCGGGCGCCGCGGCGGCGGCGGG - Exonic
1122346811 14:101066010-101066032 GCGGGCGCCACGCCTGAGGCGGG + Intergenic
1122688965 14:103522667-103522689 GCGCGCGCCGGACCGGCCGGGGG - Intronic
1122768256 14:104085759-104085781 GCGCGCGCCATGCCGGACCGGGG - Exonic
1124109321 15:26772499-26772521 CCGCGCCCCGCGCCGGAGCTGGG - Intronic
1126626091 15:50686884-50686906 GCGCGCGGCGCGCAGGGAGGCGG - Intergenic
1126766909 15:52019073-52019095 GCGCGCGCCGCGGAGGCGGTGGG - Intronic
1127997697 15:64163129-64163151 TCCGGCGCCGAGCCGGAGGGGGG - Exonic
1128322707 15:66704078-66704100 GAGCGCGCTGCGCCGGCCGGGGG + Intronic
1128374793 15:67066744-67066766 GCGCGGGCCGCGGGGGCGGGAGG - Intronic
1129503209 15:76059802-76059824 GCGCGCGCGCGGCCGGCGGGAGG + Intergenic
1129710717 15:77819173-77819195 GCGCGCGCCGCGCCGCCGGCGGG + Intronic
1129803951 15:78438550-78438572 GCGGGTGTCGCGCAGGAGGGTGG - Intronic
1130224401 15:82046251-82046273 GCGCGCGCCAGGCCGGGGGCGGG + Intergenic
1131060302 15:89400184-89400206 ACAGGCGCCGCGCCGGCGGGAGG - Intergenic
1131838014 15:96409494-96409516 TCGCGCCCCGCGCCGGCGGCCGG - Intergenic
1132604563 16:788378-788400 GCGCGCGCAGCGGTGCAGGGCGG - Intronic
1133156314 16:3879678-3879700 CCTCGCCCCGCGCGGGAGGGTGG - Intronic
1133597218 16:7304352-7304374 GCGCCCGCCGAGCCCGAGTGGGG - Intronic
1133784546 16:8963959-8963981 GCGGGCGCCGAGCCGGAGGGCGG + Intronic
1136365028 16:29806032-29806054 GCGCGGGGCGGGCAGGAGGGGGG - Intergenic
1141830759 16:86508941-86508963 GCGTGCGCAGGGCGGGAGGGGGG - Intergenic
1142631288 17:1228474-1228496 GCGGGGGCCAGGCCGGAGGGAGG + Intronic
1142699218 17:1649336-1649358 GCGCGCGGCCCGCGGGAGGGAGG + Intronic
1142763447 17:2053954-2053976 TCGCGCTCCGCGGTGGAGGGAGG + Intergenic
1146794272 17:35770148-35770170 GCGCGCGCGGCGCGGGCGAGTGG + Exonic
1147110456 17:38257403-38257425 GCGCACGCCGGGGCAGAGGGCGG + Intergenic
1147139626 17:38453880-38453902 GCGCGCGCCGCGCGGGGGCCCGG - Intronic
1147990009 17:44326806-44326828 GCGCGGGCGGTGGCGGAGGGGGG + Intergenic
1148113421 17:45161024-45161046 GCTGGCGCCGCGGGGGAGGGCGG - Intronic
1148471540 17:47896528-47896550 GAGCCCGCCGGGCGGGAGGGCGG + Intronic
1148685352 17:49497576-49497598 CCGCGCGCCGAGGCGGAGGCGGG - Intronic
1150108243 17:62478102-62478124 CCGCGCGTCGCCCGGGAGGGCGG - Intronic
1150168492 17:62966656-62966678 TCGCGGGCGGCGCCGGCGGGCGG + Intergenic
1150830311 17:68512676-68512698 GCGCCCGCCGGGCCGGGGAGGGG - Intronic
1151708397 17:75784996-75785018 GCGCGCGCGGCGGGGGGGGGGGG - Intronic
1151802176 17:76384974-76384996 GCGCGCGTCGCAACGGAGCGGGG + Exonic
1152175124 17:78782241-78782263 GCGAGCGGCGAGCCGGAGCGCGG - Exonic
1152362730 17:79839917-79839939 GCGCGGGCCCCGCCGGCAGGGGG + Intergenic
1152697426 17:81804093-81804115 GCGAGGGCGGCGGCGGAGGGCGG - Intergenic
1152748412 17:82051631-82051653 GCGCGCGCGGGGCCGGGGCGGGG + Exonic
1152798736 17:82321531-82321553 GCGCGTCCAGCCCCGGAGGGCGG + Exonic
1152924390 17:83080531-83080553 GCGCGCGCCGCGGCCAAGGGCGG - Intronic
1153015643 18:580329-580351 TCCCGCGCCGCGCCGGCGGGGGG + Intergenic
1155199353 18:23503595-23503617 GCGGGCGCCGCGCCCGCGGCGGG - Exonic
1155654537 18:28177872-28177894 GCGCGGTCGGCGACGGAGGGCGG - Intergenic
1160719444 19:590821-590843 CCACCCGCCGCGCCGCAGGGCGG - Intronic
1160724186 19:610411-610433 GCGGGCGCCGGGCGGGCGGGAGG + Intronic
1160739633 19:680002-680024 GCGCGGGCCGGGGCGGGGGGGGG - Intronic
1160791396 19:925352-925374 GGGCGGGCGGCGTCGGAGGGAGG - Intergenic
1160791634 19:926150-926172 GCGCGCCCCGCGCCTGGGGTCGG - Intronic
1160831489 19:1106685-1106707 GCGTGCACCCCGCCGGAGGAAGG + Exonic
1160838396 19:1135562-1135584 GGGCGCGGGGCGCCGGAGGTGGG - Intronic
1161203659 19:3029259-3029281 GGCCGAGCCCCGCCGGAGGGAGG - Intronic
1161249027 19:3270676-3270698 GCGGGCGCCGGGCCGCGGGGTGG + Intronic
1161333843 19:3700479-3700501 GGGCGCGCCGGGCCGGCGCGGGG + Exonic
1161753005 19:6110838-6110860 GCGCGCGCGGCGCCGTGGGTTGG + Intronic
1161955045 19:7489038-7489060 CGGCGCGCCGCGCCAGGGGGCGG + Intronic
1162797811 19:13095628-13095650 GCTGGGGCCGGGCCGGAGGGTGG + Exonic
1162914059 19:13865154-13865176 CCCCGCGCCGCGCCGGGCGGTGG - Intronic
1163117991 19:15199969-15199991 GCGCGAGGCCGGCCGGAGGGAGG + Intronic
1163453041 19:17390517-17390539 GTGCGCGCCGCGCCGGCCGCCGG + Intergenic
1163782575 19:19258151-19258173 GCGCGCGCAGCTCCGGAGAAGGG + Exonic
1164658568 19:29942435-29942457 GGGCGCGCGGTGCCTGAGGGCGG + Exonic
1165888949 19:39099160-39099182 GCGCGCGCAGGGACGGTGGGGGG + Intronic
1166136112 19:40778217-40778239 GAGCGGGTCGCGCCGGAGGGGGG + Exonic
1167587649 19:50384048-50384070 GCGCGCGCAACACCCGAGGGTGG + Intergenic
1168100034 19:54136599-54136621 GAGCGCTCCGCCCGGGAGGGAGG + Intergenic
1168561673 19:57389833-57389855 GCGTGCGCACCGTCGGAGGGCGG + Intronic
925027468 2:621143-621165 GGGCGCGCCCAGCCGGAGGCTGG - Intergenic
925609383 2:5691535-5691557 GCGCGCCCCGCCCCGGGCGGGGG - Intergenic
926216998 2:10912048-10912070 GCGCGCCCCGGGGCGGAGGACGG + Exonic
926580886 2:14632503-14632525 CCGCGCGCCGCCCCGGGGAGCGG - Intergenic
928313808 2:30231393-30231415 GCGCTCGCAGCTCCGGCGGGCGG - Intergenic
932152676 2:69387266-69387288 GCGCGCTGCGCGCCGAGGGGCGG - Intergenic
932495666 2:72144701-72144723 GCGCGGGCCACACCGGAGAGCGG - Intronic
935646263 2:105337690-105337712 GGGCGCGCCGGATCGGAGGGTGG + Intronic
937421034 2:121755609-121755631 GCTCGCGGCGCGCCGGAGGACGG - Exonic
938320081 2:130356507-130356529 GCGGGCGCCGCAGGGGAGGGCGG + Intronic
942023909 2:171894307-171894329 ACGCGCGCGGCGCCGGCGAGAGG - Intronic
943646050 2:190408565-190408587 GCACGGGCCCAGCCGGAGGGCGG + Intronic
947602676 2:231464263-231464285 GCGAGCGCGGCGCCGCGGGGAGG - Intronic
948983755 2:241508184-241508206 GAGCCCGCCGCCCCGGAGGTCGG - Intronic
1168800872 20:642545-642567 GCGCTCGCAGTTCCGGAGGGGGG + Intergenic
1170578619 20:17681972-17681994 GCGCGGGCCGGGCCGTCGGGGGG - Intronic
1170630020 20:18057763-18057785 GGCCGCGCCGCGGCGGGGGGTGG - Exonic
1171444842 20:25195940-25195962 GCGCGCTGCGCTCCGGAGGACGG + Intronic
1171452835 20:25248021-25248043 CTGCGCGCCGCGCCGGGGCGGGG - Intergenic
1172118436 20:32584541-32584563 GCGCGCGCGGCGGCCGCGGGCGG - Intronic
1172474440 20:35226635-35226657 GCGCGCCCCGCCCCGGTGGGGGG - Exonic
1173807471 20:45935097-45935119 GCGCGCGGCGGGGCGGGGGGCGG + Intronic
1173848139 20:46200943-46200965 GCGCGTGCTGCGCAGGCGGGAGG - Intronic
1175997153 20:62817011-62817033 GCGGGCGGCGCGCGGGCGGGCGG - Intronic
1176178635 20:63739778-63739800 GCCCGCGCCGCGCCGCCCGGAGG - Intronic
1176550153 21:8217345-8217367 CCGCGCGCCGAGGAGGAGGGGGG - Intergenic
1176569081 21:8400380-8400402 CCGCGCGCCGAGGAGGAGGGGGG - Intergenic
1176576995 21:8444615-8444637 CCGCGCGCCGAGGAGGAGGGGGG - Intergenic
1178334515 21:31731739-31731761 CCTCGCGCCGCGGCGGAGCGGGG + Exonic
1179529727 21:42010422-42010444 GGGCGCCGGGCGCCGGAGGGCGG + Intergenic
1179639584 21:42738523-42738545 GAGAGAGCCGAGCCGGAGGGTGG - Intronic
1179674840 21:42974450-42974472 GCGCCCGCCGCCGCGCAGGGAGG + Intergenic
1179675004 21:42975032-42975054 GCGCGCGCCCCGGCGCGGGGCGG + Intronic
1179891789 21:44339040-44339062 GCGAGGGCGGAGCCGGAGGGAGG - Intronic
1180061196 21:45385903-45385925 CTGCGTGCCTCGCCGGAGGGAGG + Intergenic
1182355364 22:29720312-29720334 GGGCGCGCGGCTGCGGAGGGCGG - Exonic
1183365248 22:37403405-37403427 GCGAGCGAGGGGCCGGAGGGTGG + Intronic
1183653425 22:39171774-39171796 GCGCGAGCGGCGCCGGATGGAGG + Intergenic
1183702466 22:39457902-39457924 GGGGGAGCCGCGCCGGAGGCTGG - Intronic
1184680794 22:46071343-46071365 GCGCGCGCCGTCCCGGGGTGGGG + Intronic
1185330803 22:50251328-50251350 GCGAGCTCCGCCCCGGAGCGAGG + Exonic
1203255046 22_KI270733v1_random:133677-133699 CCGCGCGCCGAGGAGGAGGGGGG - Intergenic
1203263102 22_KI270733v1_random:178756-178778 CCGCGCGCCGAGGAGGAGGGGGG - Intergenic
949915801 3:8963480-8963502 GCCCGCGACGCGCCAGAGGCGGG + Exonic
950743004 3:15064796-15064818 TCGCCCACCGCGCCGGAGGAAGG + Intronic
951078691 3:18425775-18425797 GCGCGCGGCGCGCGGGCGGCAGG + Intronic
960096620 3:113696289-113696311 GCGGGGGCGGCTCCGGAGGGCGG - Intronic
961820682 3:129574283-129574305 GCATGCGCCGTGCCGGAGTGCGG + Intronic
963335763 3:143972201-143972223 GCGCGGGCTGGGGCGGAGGGCGG - Exonic
965390209 3:168095447-168095469 GCGCGCCCCGCGCCGCGCGGGGG - Exonic
966390944 3:179451608-179451630 GCGCGCGCAGCCCGGGCGGGGGG + Intergenic
966849365 3:184155332-184155354 GGCCGCGCCGGGCCGGAGGAGGG + Intronic
966982727 3:185153030-185153052 GCGCGCGCCGCGCCGGAGGGAGG - Intergenic
968008839 3:195260157-195260179 GCGCGCACCTCGCCGGCCGGGGG + Intronic
968457213 4:705913-705935 GCGGGGTCCGCGCCGGAGGGGGG - Exonic
968556549 4:1248843-1248865 GCGGGTGCCGCGCGGGCGGGGGG - Intronic
968775394 4:2536856-2536878 CCGCGGGCGGCGGCGGAGGGCGG - Intronic
969596194 4:8150596-8150618 GCGAGCTCCGTGCCGGAGGCGGG + Intronic
969597800 4:8158778-8158800 GCGGGCGCGGAGCCGGCGGGCGG - Intronic
971244181 4:24913226-24913248 GCGCTCTCCGCGCGGGAGGCGGG + Intronic
976600851 4:86935911-86935933 GCGCTCGCACCGTCGGAGGGTGG - Intronic
976751882 4:88457398-88457420 CCGCGCGCTGCTCCGGAGGGTGG + Exonic
979624020 4:122826733-122826755 GGGGGCGGCGCGCAGGAGGGAGG + Exonic
980022869 4:127730389-127730411 GCACGCGCCTCGCCGGCGCGCGG + Exonic
981550377 4:145936957-145936979 ACGCGGGAGGCGCCGGAGGGAGG - Intronic
984888641 4:184473242-184473264 GCGCGGGCCGCGGCGGGGTGGGG - Intronic
985129001 4:186723519-186723541 GCGCGCGACTTCCCGGAGGGTGG - Intronic
985462603 4:190121392-190121414 GCCGGCGCGGCGCCGGAGCGGGG - Intergenic
985784634 5:1887340-1887362 GCGCGCGGCGCGCCGGGTGCAGG + Intergenic
991198438 5:63961724-63961746 GCGCGCCCGGCGCGGGAAGGGGG + Exonic
994679332 5:102865923-102865945 ACGCGAGCGGCGCTGGAGGGAGG + Intronic
995224791 5:109690102-109690124 CCGCGCGCCCTGCCGGAGGTCGG + Exonic
996900589 5:128538286-128538308 GCGCGGGGCGGGCCGGCGGGCGG + Intronic
997500739 5:134371518-134371540 TCGGCCGCCGCGCCGGGGGGTGG + Exonic
997955324 5:138274521-138274543 GTGTGCGTCGCGCTGGAGGGCGG - Exonic
999300347 5:150486525-150486547 GCGGGCGCCGGGCGGGCGGGTGG + Intronic
1001035096 5:168291806-168291828 GCGCGCCGCGCGGCGGAGGAGGG + Intronic
1003683975 6:8282570-8282592 GCGCGCCCGGCGCTCGAGGGCGG + Intergenic
1003868678 6:10384859-10384881 GCGCGCGCCGGGCCGGGGCGCGG + Intergenic
1007444543 6:41895088-41895110 GCGCGCGCCTCGCGGGCGGGAGG - Intronic
1007739652 6:44002830-44002852 GCGCGCGCCCCGTCGGCGGCGGG - Exonic
1008027400 6:46653337-46653359 GCACGCGCCGCGCTGGGGGAGGG + Intronic
1008545074 6:52576998-52577020 GCGGGCGGCGGGCCGGCGGGCGG - Intergenic
1008629288 6:53348414-53348436 GCGCGCTCCGGCCCGCAGGGCGG + Intronic
1013117570 6:107114777-107114799 ACGCGCGCCGCGCGGGGGCGGGG - Intronic
1017662435 6:156687479-156687501 GCGCTCGCCGAGCCGGAGGCTGG - Intergenic
1017877667 6:158537277-158537299 GCGCGCGCTGCGGCGTCGGGAGG + Intronic
1019613923 7:1950338-1950360 GCGCGGGACGTGCAGGAGGGCGG - Intronic
1021828009 7:24573636-24573658 CCGCGCGCCGGGCCGGCCGGGGG + Intronic
1022018586 7:26376746-26376768 GCTCGCGCCCGGCCGGAGGAGGG + Intergenic
1022715186 7:32891993-32892015 GCGCGCGCGAGGCGGGAGGGCGG - Intronic
1024578286 7:50782349-50782371 GCGCGAGCCGGGGCGGCGGGCGG - Intronic
1025033061 7:55572622-55572644 GCGCGCCCCGGGCGGGAGGAGGG + Intronic
1025916841 7:65873122-65873144 GCGCGCGCGGGCGCGGAGGGAGG - Intergenic
1026013454 7:66654499-66654521 GCGCAGGCCGCGCCGGGGGCGGG + Intronic
1026968291 7:74453926-74453948 GCGCGGGCTGCGGCGGAGGGCGG - Intronic
1027400225 7:77798942-77798964 GCGAGCGCCGCGCCGCTAGGAGG - Exonic
1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG + Exonic
1028871088 7:95772495-95772517 GCCCGCGCCCCTCCTGAGGGAGG - Intronic
1029273849 7:99392883-99392905 GCGGGAGCCGGGCCGGCGGGTGG + Intronic
1029708341 7:102286843-102286865 GCGCGCGCCTCGCGGGCGGAGGG + Intronic
1030216081 7:107044885-107044907 GCGCCTGCCGCCCCGGAGGCAGG + Exonic
1032037290 7:128530636-128530658 CCGCGCGTCGCCCCGGAGGGCGG - Intergenic
1034441383 7:151087504-151087526 GCGCCCGCAGGCCCGGAGGGTGG + Intronic
1034446217 7:151115488-151115510 CCGCGCGCAGCGCCGGAGCCCGG + Intronic
1034446243 7:151115575-151115597 GCGCCCGCCGCGCCGCTGTGGGG + Intronic
1037768973 8:21788040-21788062 GCGAGCGGAGCGCCGGTGGGGGG - Intronic
1037811461 8:22089370-22089392 GGGCGCGGCCCGCAGGAGGGCGG + Intronic
1037865655 8:22440772-22440794 GCGCGACCCGCGCGGGAGGCCGG - Intergenic
1042902788 8:73746224-73746246 GGCCGGGGCGCGCCGGAGGGTGG - Intronic
1045063533 8:98427193-98427215 GCGCCCGGCGGGCCGGCGGGCGG - Exonic
1046819744 8:118621966-118621988 GCGCGCGCCGAGCCGGGAGCCGG - Intronic
1048980721 8:139702354-139702376 GCCCGCGCCGGGGCGGTGGGTGG + Intronic
1053027274 9:34740411-34740433 TCGAGCGCAGCGCCGGTGGGCGG + Intergenic
1054489436 9:65762640-65762662 GCGGGGGCCGCGGCGGTGGGGGG - Intergenic
1056163555 9:83921286-83921308 GGGCGCGGCGGGCTGGAGGGCGG + Intronic
1056369704 9:85941497-85941519 GCTGTCGCCGCGCGGGAGGGCGG - Intronic
1060700490 9:125746597-125746619 GCGCGCACCGCCCCGGGGGCGGG + Intergenic
1060713026 9:125889744-125889766 GGGCGCGCCGCGGCGGGGAGCGG + Intronic
1061127967 9:128688968-128688990 GCGCGCGGCAGGCCGGTGGGCGG - Intronic
1061248447 9:129413436-129413458 GAGCGGGCCGCGCCGGAGCTCGG - Intergenic
1061348083 9:130042859-130042881 GCGCGGGCCGCGCTGCTGGGCGG - Intronic
1061666216 9:132162166-132162188 GGAGGCGCAGCGCCGGAGGGTGG + Exonic
1062344808 9:136109764-136109786 GCGCGCACTGCGCCTGGGGGCGG - Intergenic
1062450637 9:136614359-136614381 GCGGGAGCCGGGGCGGAGGGTGG - Intergenic
1062500120 9:136848657-136848679 GCGCGGGGCGCGGCGGCGGGTGG - Exonic
1062651175 9:137578600-137578622 GCGCGCGCCGCGGCTTCGGGAGG - Intronic
1203471446 Un_GL000220v1:116817-116839 CCGCGCGCCGAGGAGGAGGGGGG - Intergenic
1203479267 Un_GL000220v1:160789-160811 CCGCGCGCCGAGGAGGAGGGGGG - Intergenic
1186669959 X:11758200-11758222 GCGCGCGCGGTGGGGGAGGGCGG - Exonic
1187172995 X:16869995-16870017 GCGCGCGCCGGGGCCGCGGGGGG - Intronic
1188003493 X:25002567-25002589 GCGCGCGCCCTGGAGGAGGGGGG - Intergenic
1199772677 X:150984262-150984284 GTGCGCCCCGCGCCGGGGGGCGG + Intronic
1200126812 X:153819100-153819122 GAGCGCGCCGCGACGGCGGCGGG + Intronic