ID: 966986624

View in Genome Browser
Species Human (GRCh38)
Location 3:185186235-185186257
Sequence TCTGAGATGCAGCCTGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966986619_966986624 26 Left 966986619 3:185186186-185186208 CCTCTGCATTTTGGATGTCTCCT No data
Right 966986624 3:185186235-185186257 TCTGAGATGCAGCCTGTTGAGGG No data
966986621_966986624 6 Left 966986621 3:185186206-185186228 CCTGCTTTGCTCAGGACACCTCA No data
Right 966986624 3:185186235-185186257 TCTGAGATGCAGCCTGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966986624 Original CRISPR TCTGAGATGCAGCCTGTTGA GGG Intergenic
No off target data available for this crispr