ID: 966990939

View in Genome Browser
Species Human (GRCh38)
Location 3:185229437-185229459
Sequence GTAATTAAGTCAAGTGCAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966990936_966990939 -1 Left 966990936 3:185229415-185229437 CCAAGGTCTATACTGACCTGAGG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 966990939 3:185229437-185229459 GTAATTAAGTCAAGTGCAGCAGG 0: 1
1: 0
2: 1
3: 5
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966990939 Original CRISPR GTAATTAAGTCAAGTGCAGC AGG Exonic
902037567 1:13468612-13468634 GTCATTAAGTCAACAGCAGGGGG + Intergenic
902557630 1:17256335-17256357 GTGATTTAGTCAAGCTCAGCTGG + Intronic
903989486 1:27256224-27256246 GCCATTAAGTCCAGTGCAGCAGG - Intronic
907064065 1:51462064-51462086 GTAATTAAAGAAAGGGCAGCCGG + Intronic
907846437 1:58212624-58212646 GAAATTAAGATAAATGCAGCTGG + Intronic
908155508 1:61348699-61348721 GTATTAAATTTAAGTGCAGCTGG + Intronic
908961562 1:69702985-69703007 GTAATTAAGCAAAGTTCAGCAGG + Intronic
909501489 1:76339818-76339840 GTTATGAATTCAAGTGAAGCAGG + Intronic
910748213 1:90597386-90597408 GAAACTAAGTGGAGTGCAGCTGG - Intergenic
911778695 1:101847273-101847295 GTAACTAACTAAAGTGGAGCTGG - Intronic
916634485 1:166653622-166653644 TTAATCAATTCAAGTGTAGCAGG + Intergenic
916932141 1:169589478-169589500 ATAGTTAAGTCCAGTGTAGCAGG + Intronic
917168009 1:172134864-172134886 GTAATTAAGTCCAGTGTGACTGG + Intronic
920297125 1:204965411-204965433 GAAATGCAGTCAATTGCAGCAGG - Intronic
1074705312 10:116124842-116124864 GTGATTAAGTCGAGAGGAGCTGG - Intronic
1076025065 10:127105025-127105047 GTAATTGAATCATGAGCAGCAGG + Intronic
1076253597 10:129002315-129002337 GCAATGAAGTCCACTGCAGCAGG + Intergenic
1083793319 11:64999930-64999952 TTAATTAATTAAAGTCCAGCAGG + Intergenic
1089632878 11:119794446-119794468 GTAAATAAATCGAGGGCAGCGGG - Intergenic
1089881344 11:121776557-121776579 GTGATTAAGTCAGGTCCACCAGG - Intergenic
1090394812 11:126411869-126411891 GTAATTAGGTCAAGCTCAGCAGG + Intronic
1099869496 12:88328840-88328862 GTAAGTATGTTAAATGCAGCAGG - Intergenic
1107155449 13:37161781-37161803 GTAATTTAGTCAAGTTTAGAGGG - Intergenic
1109248523 13:59988047-59988069 GTAAGTAGGTCAAGAGCAGTGGG - Intronic
1111753950 13:92368818-92368840 CTAATTAAGTTAACTGAAGCCGG + Intronic
1119167043 14:72503182-72503204 GTAATTAGGTCACGTGGAGTGGG - Intronic
1122394464 14:101413542-101413564 GTAATTAAATCATGAGGAGCGGG - Intergenic
1202933185 14_KI270725v1_random:58701-58723 GTAATTCAGTCAAATGAGGCAGG + Intergenic
1126586118 15:50289294-50289316 GTAATTAAGTCTATTGCAAAGGG + Intronic
1128033370 15:64501196-64501218 GTAATTAGATCAGCTGCAGCAGG + Intronic
1134896412 16:17891211-17891233 TTAATTAAGTCAAATTCATCTGG + Intergenic
1138885822 16:61077578-61077600 GTAATCCAGTCACTTGCAGCAGG - Intergenic
1139036679 16:62955827-62955849 TTAATTAATTCAAGTCCAGCAGG - Intergenic
1140681809 16:77392544-77392566 GTAATGAAGGAAAGTGAAGCAGG - Intronic
1148386907 17:47240624-47240646 GTAATTAGCTCAAGAGCACCAGG - Intergenic
1149558803 17:57593703-57593725 CTAATTAGGACAAGTGTAGCAGG - Intronic
1151988625 17:77559756-77559778 GAAAATAAGTTAATTGCAGCAGG - Intergenic
1154492723 18:14933807-14933829 GCAACTACGTCAAGTGCAGATGG + Intergenic
1155015431 18:21834080-21834102 TTAATTAACTAAAGTGCTGCAGG + Intronic
1158410673 18:57202944-57202966 GTGATTAATTCAACTTCAGCTGG + Intergenic
925586240 2:5467330-5467352 ATAATGAATTCAAGTCCAGCTGG - Intergenic
927141688 2:20135316-20135338 GTAGTGAAGAGAAGTGCAGCAGG - Intergenic
932046842 2:68358254-68358276 GAAATTCAGGGAAGTGCAGCAGG - Intergenic
937817034 2:126262339-126262361 TTAATTAAGTGAAGTGTAGAAGG - Intergenic
939729466 2:145764241-145764263 GACATAAAGTGAAGTGCAGCTGG + Intergenic
943026606 2:182637057-182637079 GTAATTAAGCTAGGTCCAGCAGG + Intergenic
1176594589 21:8680872-8680894 GTAATTCAGGCAAGTGAGGCAGG + Intergenic
1180277441 22:10658001-10658023 GTAATTCAGGCAAGTGAGGCAGG + Intergenic
1203301123 22_KI270736v1_random:77836-77858 GGAATTGAGTGAAGTGCAGTGGG + Intergenic
949575374 3:5333545-5333567 GTAAATCAGTCAAATGCAGGTGG + Intergenic
949644010 3:6072280-6072302 GTGATTAAGGCAAGTGCATTGGG - Intergenic
951146821 3:19236912-19236934 ATAATAAAGTCAAGTTCAACTGG - Intronic
953115864 3:39991840-39991862 GTAATGAATTCAAGTGCCCCTGG + Intronic
955832667 3:63020999-63021021 ATAATTAAGTCTAGTGCTGATGG - Intergenic
957475977 3:80724783-80724805 GTATTTATGTCAAGTGCATTGGG - Intergenic
959622835 3:108416981-108417003 GTCAGTAAGTCAAGTGAAGGAGG - Intronic
959690398 3:109191803-109191825 GTACTTAAGTCATGTGCTGGGGG + Intergenic
961431095 3:126883678-126883700 GTAATTTGGTCAAAGGCAGCAGG - Intronic
962154204 3:132927502-132927524 GGAATTTAGTCAAGTTCACCCGG + Intergenic
963306551 3:143659868-143659890 GTAATTAAATCATGAGGAGCTGG + Intronic
965047018 3:163591881-163591903 GTAATTAAGTGATGTGCACTCGG + Intergenic
966990939 3:185229437-185229459 GTAATTAAGTCAAGTGCAGCAGG + Exonic
971453785 4:26824310-26824332 CTTATTAAGACAACTGCAGCTGG + Intergenic
973260755 4:48160865-48160887 GGAATTAATTCAAAAGCAGCGGG + Intronic
980082516 4:128359107-128359129 GTCATTAAGCCAAGTGCCCCAGG - Intergenic
980143965 4:128957804-128957826 GTAAATATTTCAAGTGCTGCTGG - Intronic
983374150 4:166901652-166901674 GGAATTAAGTCAGGTGCAGCAGG - Intronic
986407279 5:7438644-7438666 GAAATTAAGTCACATACAGCGGG - Intronic
990245327 5:53858451-53858473 GGAATTAAATGAAGTGCAGGAGG - Intergenic
991293194 5:65053194-65053216 GAAATCATGTCATGTGCAGCAGG - Intergenic
992295745 5:75324846-75324868 ATAAATGAGTCAGGTGCAGCTGG + Intergenic
993158100 5:84253119-84253141 GTAATTAAGTTAGGTGCACTGGG + Intronic
996828858 5:127717576-127717598 AGAATTTAGTCAATTGCAGCAGG - Intergenic
1000001629 5:157144000-157144022 GCAATTGAGTAAAGTGCAACTGG - Intronic
1001405154 5:171471197-171471219 GTAGTTAAGTCTCTTGCAGCTGG + Intergenic
1001767080 5:174258413-174258435 ATAATGAATTCAAGTGCATCTGG - Intergenic
1005464367 6:26097723-26097745 ATCATTGAGTCAAGTACAGCAGG + Exonic
1005642213 6:27807226-27807248 GTAAGTCAGTCAAGCGCATCCGG - Intergenic
1010114992 6:72294396-72294418 GGAAGGAAGTCAAGTGCAGTAGG - Intronic
1033148129 7:138888972-138888994 GTAGTTAAATGAAGTGCTGCTGG - Intronic
1038654453 8:29436531-29436553 GTAATTAGGCCAGGTGCAGTGGG + Intergenic
1039287091 8:36053686-36053708 TTAATTAAGTCATGTGGAGTGGG - Intergenic
1039996986 8:42542085-42542107 GGAAGAAAGTCAAGTGGAGCAGG - Intronic
1042836967 8:73087767-73087789 ATAATTAACCCAAGTGAAGCAGG - Intronic
1045756440 8:105548935-105548957 GTATTTAAGTAAAGTTCAGCTGG + Intronic
1048555465 8:135471555-135471577 GTAATAAAGACAAGTGCACACGG + Intronic
1050856443 9:10363027-10363049 GAAATTCAGTGAAGTACAGCTGG + Intronic
1052507178 9:29370866-29370888 GTAACTATTTCAAGTGAAGCAGG + Intergenic
1056343886 9:85670446-85670468 TTAATTAAAGCAAGTGTAGCAGG + Intronic
1186092482 X:6064639-6064661 GCAAATGAGGCAAGTGCAGCGGG + Intronic