ID: 966990944

View in Genome Browser
Species Human (GRCh38)
Location 3:185229465-185229487
Sequence CAGTGAGTCTGGGGAGAAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 563
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 505}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966990936_966990944 27 Left 966990936 3:185229415-185229437 CCAAGGTCTATACTGACCTGAGG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 966990944 3:185229465-185229487 CAGTGAGTCTGGGGAGAAGCTGG 0: 1
1: 0
2: 3
3: 54
4: 505
966990938_966990944 11 Left 966990938 3:185229431-185229453 CCTGAGGTAATTAAGTCAAGTGC 0: 1
1: 0
2: 1
3: 10
4: 143
Right 966990944 3:185229465-185229487 CAGTGAGTCTGGGGAGAAGCTGG 0: 1
1: 0
2: 3
3: 54
4: 505

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966990944 Original CRISPR CAGTGAGTCTGGGGAGAAGC TGG Exonic
900331550 1:2137276-2137298 CAGTGCGGCTGGGGCAAAGCAGG - Intronic
900489713 1:2941699-2941721 CAGTGTGTCTGGGGAGAGTGTGG + Intergenic
900497553 1:2982899-2982921 CAGAAAGTCTGGGAAGAAACTGG - Intergenic
900742032 1:4336178-4336200 CAGGGAGGCTGGGGAGGAGGAGG + Intergenic
900830737 1:4963555-4963577 CAGTAAGACTGGGGAGCAGGGGG - Intergenic
901010581 1:6199480-6199502 CAGCGAGCCTGGGTAGATGCCGG + Intronic
901183786 1:7359199-7359221 CAGTGAGTCTCTGGAGACCCAGG + Intronic
901201841 1:7471620-7471642 CAGTGGGTCAGGGGAGGAGCAGG + Intronic
901487874 1:9577858-9577880 TATTCAGTTTGGGGAGAAGCAGG - Intronic
902183822 1:14710453-14710475 AGGTGAGGCTGGTGAGAAGCTGG - Intronic
902615607 1:17621963-17621985 AAGGGTCTCTGGGGAGAAGCAGG + Intronic
902783930 1:18721082-18721104 GAGGGAGTGTGGAGAGAAGCTGG - Intronic
902792016 1:18775809-18775831 CAGGGGATCTGGGGTGAAGCTGG - Intergenic
903386236 1:22928864-22928886 CGGGGAGCCAGGGGAGAAGCAGG + Intergenic
903671572 1:25039053-25039075 CAGTGAGTCTGTGGCATAGCTGG + Intergenic
903766445 1:25737871-25737893 CAGGGAGTCTGAGGAGCTGCTGG + Intronic
903798182 1:25946103-25946125 CAGTGAGTCTGGGGGCTGGCAGG + Intergenic
903960139 1:27051881-27051903 CAGTGAGTGAGGGGCAAAGCAGG - Intergenic
904276427 1:29387643-29387665 CAGGGGGTCTGGGGAGGAGCAGG + Intergenic
904310357 1:29625329-29625351 GGGTGAGACTGGGGAGAGGCTGG + Intergenic
904839391 1:33362307-33362329 CTGTGAGTCTGGGGTGCAGGAGG + Intronic
904950557 1:34234984-34235006 CAGTGAGACTGAGGACTAGCTGG - Intergenic
905218295 1:36425924-36425946 CCGGGAGTCTGGGGGGAGGCAGG + Intronic
906125440 1:43424409-43424431 CAGTGAGGATGGAGAGGAGCTGG - Exonic
907320149 1:53596820-53596842 CAGAGACTCAGGGGAGAGGCAGG + Intronic
907795138 1:57708578-57708600 CAGTTAGTCAGTGGTGAAGCTGG + Intronic
908524586 1:64975761-64975783 CAGTGAGTCAAGGGAGTACCAGG + Intergenic
908534555 1:65066420-65066442 AGGTGAGCCCGGGGAGAAGCGGG + Intergenic
909163210 1:72181417-72181439 TAGTGAGTGTGTGGAGAAGAGGG + Intronic
910291163 1:85601844-85601866 CAGTGTGTCTGGCCAGCAGCTGG - Intergenic
910535396 1:88292073-88292095 CAGTGAGTCTTGGCAGCACCAGG + Intergenic
911401366 1:97379247-97379269 CAGTGACAATGGGGAGAGGCAGG + Intronic
912385018 1:109267162-109267184 CAGACAGTCTGGGGAGTAGGGGG + Intronic
912628776 1:111228583-111228605 TAGTGAGTGTGTGGAGAACCAGG + Intronic
915131649 1:153699201-153699223 CAGTGAGTCAGAGGATAGGCTGG + Intergenic
915457524 1:156050819-156050841 CTGTGAGTCTGGGGAAAAGTTGG - Intronic
915580235 1:156808999-156809021 GAGCGACTCTGGGGAGAAGAGGG + Intronic
915658414 1:157380802-157380824 CAGTGACGTTGGGCAGAAGCTGG + Intergenic
915887658 1:159740473-159740495 CAGAGGGTCTGGGGATAAGATGG + Intergenic
916446926 1:164881150-164881172 CCGGGAGTCTGGAGAGAAGTGGG + Intronic
916577201 1:166078693-166078715 TGGGGAGTCTGGGGAGAGGCTGG + Intronic
916723414 1:167502314-167502336 CAGATAGTCTTGGAAGAAGCTGG + Intronic
917348003 1:174048899-174048921 CTGTGAGTTAGGGGAGAAGATGG - Intergenic
917633886 1:176916914-176916936 AAGTGAGGCTGGAGAGAGGCTGG - Intronic
920442446 1:205989902-205989924 CAGTTACTCTTGGGAGAAGTGGG - Intronic
920730743 1:208481728-208481750 CAGTGACAGTGGGGAGAAGAAGG - Intergenic
920766069 1:208835130-208835152 CTGTGTGTGTGGGGAGAGGCAGG - Intergenic
921134689 1:212249561-212249583 CAGTTAGTCTGGGTTGAGGCTGG + Intergenic
921535318 1:216342345-216342367 TAGTGAGACTGTGGAGAAACAGG + Intronic
921828412 1:219700099-219700121 CAGGGAGTAAGGGGAGAAGCGGG + Intronic
922247359 1:223813540-223813562 CAGTGGGACAGGGGAGAAGAGGG - Intronic
922715258 1:227866869-227866891 AAGTCAGTCTGGGGAGAGGAAGG - Intergenic
922732222 1:227954923-227954945 CGGTGAGTGTGTGGAGAAACTGG - Intergenic
923456334 1:234168703-234168725 CAGTGAGGCTGGGCAGTGGCAGG + Intronic
923538548 1:234871526-234871548 CAGCAGGGCTGGGGAGAAGCAGG - Intergenic
923570328 1:235107704-235107726 CAGTGAGGCTGGAAAGAAGTGGG + Intergenic
924085920 1:240451501-240451523 CAGTGGTTCTGGGGATGAGCTGG + Intronic
924220788 1:241873289-241873311 CATTGAGTCTAGAGGGAAGCAGG + Intronic
924820657 1:247487366-247487388 CAGTGAATGTGGGGAGAGGTAGG + Intergenic
1063437201 10:6044019-6044041 CACTGAGTTTGGGGAGAGGGGGG - Intronic
1063646613 10:7890100-7890122 GAGTGAAACTGGGCAGAAGCCGG - Intronic
1063663823 10:8050419-8050441 CTGTGAGTCTGGGGAGGAAGTGG - Intergenic
1064021521 10:11813126-11813148 CAGTGAGTCTGGGAAGACGATGG - Intergenic
1064103818 10:12484816-12484838 CAGTGACTCTGGGGGGGAGGGGG + Intronic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1067229443 10:44396348-44396370 AAGTGAGTATGGGGAGGGGCAGG - Intergenic
1067703835 10:48592522-48592544 CGGTGAGGGAGGGGAGAAGCGGG - Intronic
1068368976 10:56089614-56089636 TGGTGAGGCTGTGGAGAAGCAGG + Intergenic
1068721063 10:60246846-60246868 GGGTGTGTGTGGGGAGAAGCAGG - Intronic
1068963194 10:62886115-62886137 CAGTGAGTCAGGAGGGAAGCTGG + Intronic
1069614058 10:69795211-69795233 CAGTGGGTCTGGGCAGCATCTGG + Intergenic
1069689328 10:70339503-70339525 ATGTGAGTCTGGGATGAAGCAGG + Intronic
1069994991 10:72336503-72336525 GAGTGAGTGTGGGGGGAAGGCGG - Exonic
1070193039 10:74130399-74130421 CAGTTACTCTGGGGACCAGCTGG - Intronic
1070266037 10:74904149-74904171 CAGTGAGTCTCCAGAGAAGCTGG - Intronic
1071698868 10:87907396-87907418 GATTGCATCTGGGGAGAAGCAGG + Intronic
1071700505 10:87927802-87927824 AAGTGAGTCTGGTAAGCAGCAGG + Intronic
1071717090 10:88107966-88107988 CATGGAGTCTGGGGAGAGTCGGG + Intergenic
1072114529 10:92357508-92357530 CAGGGGGTGTGGGGAGAAGTGGG - Intergenic
1072797340 10:98366035-98366057 CAGTGAGTCTGTGGCCAGGCGGG - Intergenic
1073069593 10:100784791-100784813 CTGTGACTCTGGGGAAAAACTGG + Intronic
1073793938 10:106967587-106967609 CAGGGAATAGGGGGAGAAGCTGG + Intronic
1074572091 10:114633300-114633322 TGGTGGGTCTGGGGAGAAGCGGG + Intronic
1075025396 10:118980101-118980123 CAGGGAGTGTGGGGAGAGCCGGG - Intergenic
1075706463 10:124504892-124504914 CAGTGCGTCTGGGAGGGAGCGGG + Intronic
1076048593 10:127314433-127314455 CATTCATGCTGGGGAGAAGCCGG + Intronic
1076088383 10:127656513-127656535 CAATGAGGCTGAGGAGGAGCAGG - Intergenic
1076554933 10:131315093-131315115 CTGTGAGACTGGGGAGAGCCTGG + Intergenic
1076581860 10:131517229-131517251 GAGGGAGGCTGGGGAGCAGCTGG - Intergenic
1076824175 10:132958972-132958994 CAGCGAGACTGGGGAGCAGCAGG + Intergenic
1076835957 10:133021017-133021039 GTGTGTGTTTGGGGAGAAGCTGG + Intergenic
1077005450 11:353386-353408 CAGTGAGTCTGAGATGAAACTGG - Intergenic
1077281818 11:1749385-1749407 CAGTGGGTCCGGGGAGATGGAGG - Intronic
1077290887 11:1792083-1792105 CACAGAGTCTGGGGAGGGGCAGG - Intergenic
1078090987 11:8264532-8264554 CCAGGATTCTGGGGAGAAGCAGG - Intronic
1078921342 11:15833491-15833513 CAGTGTGTCTGGGGAGTAACAGG + Intergenic
1079453744 11:20619463-20619485 CACAGAGTGTGGGGAGAATCAGG + Intronic
1081896644 11:46592914-46592936 CAAAGAGGCTGGGGAGAAGGAGG + Intronic
1082921642 11:58501409-58501431 AAGTGAGGCTTGGGAGAAGAGGG + Intergenic
1083830115 11:65226027-65226049 CAGTGTGTCTGGGGTGAGGTGGG + Intergenic
1083848888 11:65354109-65354131 CAGCGAGGCTGGAGAGCAGCTGG + Intergenic
1083902834 11:65652037-65652059 CAGTGACAGTGGGGAGAAGTGGG + Intergenic
1084295831 11:68213117-68213139 CGGTGAGTCGGGGGAGGGGCGGG - Exonic
1084913813 11:72412345-72412367 CAGTGAGGGAGGGGAGAGGCTGG + Intronic
1085403234 11:76246802-76246824 CAGTAAGTCATGGGAGAAGGAGG - Intergenic
1086062997 11:82719526-82719548 CTGTGAGTCTGGGGAAGAACTGG + Intergenic
1086989547 11:93287990-93288012 CAGTGGGTCTAGGGAACAGCTGG + Intergenic
1087141903 11:94772363-94772385 GAGTGAGGATGGGGAGAAGAGGG - Intronic
1087278689 11:96185971-96185993 CAGTAGGTCTGGGGAGGGGCTGG - Intronic
1088763853 11:112958142-112958164 CAGAGAGTCTGGGGCGGAGAGGG - Intergenic
1088850054 11:113696964-113696986 GAGTGAGTCTTGGCAGAAGAAGG + Exonic
1088920804 11:114258567-114258589 CAGAGGGTCTGGGCTGAAGCAGG - Intronic
1089592395 11:119551845-119551867 CAGTGAGTCAGGAGAGTGGCTGG + Intergenic
1090105999 11:123854291-123854313 CACAGAGAGTGGGGAGAAGCAGG + Intergenic
1090668433 11:128930436-128930458 CAGGGAGGGTGGGGAGAAGAAGG - Intergenic
1091161847 11:133429951-133429973 CAGTGAGTCTGGATGGAAGCGGG + Intronic
1091209292 11:133842915-133842937 CAGTGGGTGTGGGGTGATGCAGG - Intronic
1091278839 11:134370533-134370555 CAGGGAGTGTGGGGGGAGGCAGG + Intronic
1091630250 12:2154514-2154536 CAGTGGGTCAGGGAAGAGGCTGG + Intronic
1092104528 12:5912193-5912215 CAGTGGGTCTAGTGAAAAGCAGG - Intronic
1093458401 12:19386464-19386486 CAGAGAGTCTAGGGAGACTCTGG - Intergenic
1096009889 12:48203953-48203975 GAGTGAGTCTGGGAAGAGGTGGG - Intergenic
1096843006 12:54390665-54390687 CAGAGGGGCTGGGGAGAAGAGGG - Intronic
1096871244 12:54593784-54593806 CAACAAGGCTGGGGAGAAGCAGG - Intergenic
1097221247 12:57452457-57452479 CAGTGAGGGTGGGGAGAGGTGGG + Intronic
1097344782 12:58478570-58478592 CGGTGAGTTAGGGGAAAAGCAGG + Intergenic
1097419266 12:59353809-59353831 AGGGGAGTTTGGGGAGAAGCTGG + Intergenic
1098014803 12:66092846-66092868 CAGTGGGTCTGGAGCCAAGCAGG - Intergenic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098933726 12:76452504-76452526 AACTGAGTTTGGGGAGAGGCAGG - Intronic
1099328157 12:81245996-81246018 CAGTGCCTCTGGGGAGAGGAAGG + Intronic
1103254776 12:119531679-119531701 CAGTGAGTATGGAAGGAAGCAGG + Intronic
1103995521 12:124827549-124827571 AGGGGAGGCTGGGGAGAAGCTGG + Intronic
1104603407 12:130169137-130169159 CAGTGGGGCTAGGGGGAAGCAGG + Intergenic
1104676176 12:130713990-130714012 CAGCAGGTCTGGGGAGGAGCCGG - Intronic
1104791306 12:131483750-131483772 CAGTAAGTCTGGAGACAAGTGGG + Intergenic
1104805445 12:131586581-131586603 CAGTGGAGCTGGGGAGAAACGGG + Intergenic
1104955511 12:132463380-132463402 CAGTGTGCCTGAGGAGAAACAGG + Intergenic
1105409810 13:20161690-20161712 AAGTGTGTCTGAAGAGAAGCAGG - Intergenic
1106539594 13:30678163-30678185 CAGGGACTCTGGGAAGTAGCAGG + Intergenic
1106543217 13:30708696-30708718 CAGTGAGCATGTGGAGTAGCTGG - Intergenic
1107386417 13:39914579-39914601 CAGAGGCTCTGGGGAGAATCTGG - Intergenic
1109016803 13:57025884-57025906 TGGTGAGGCTGTGGAGAAGCAGG - Intergenic
1109300528 13:60585712-60585734 CCGAGACTGTGGGGAGAAGCAGG + Intergenic
1110299768 13:73912857-73912879 CTGTGAGTGAGGGGAGAAGAAGG - Intronic
1110525821 13:76535658-76535680 CAGTGAGGCTGTGGAGAAATAGG + Intergenic
1111266988 13:85829143-85829165 CAGTGAGGCTGGGGAGATGTTGG + Intergenic
1111991034 13:95117411-95117433 CAGTGGCCCTGGGGAGGAGCTGG + Intronic
1112546179 13:100373290-100373312 CGGTGAGGGTGTGGAGAAGCTGG + Intronic
1112709874 13:102115270-102115292 CAGAGAGGGTGGGGACAAGCGGG - Intronic
1113313717 13:109157155-109157177 AAGAGAGTCAGGGGAGAGGCTGG - Intronic
1113744547 13:112734469-112734491 AAGTGAGTCTGGGCAGAAATTGG + Intronic
1113854845 13:113437477-113437499 CAGTGGGGCTTGGGAGAGGCAGG - Intronic
1113933550 13:113981397-113981419 CAGAGAGGCTGGGAGGAAGCAGG + Intronic
1114145567 14:19973045-19973067 CACAGTGTCTGGGGAAAAGCAGG + Intergenic
1115427144 14:33273180-33273202 CAGTGAGTCTGGGGAAGAGCGGG - Intronic
1115453066 14:33571141-33571163 CATTGAGTCTTTGGAAAAGCAGG + Intronic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1117736028 14:58769449-58769471 CAGTGAGTGTGGGGTGAGCCTGG - Intergenic
1118302190 14:64625837-64625859 CAGGGGGTGCGGGGAGAAGCTGG - Intergenic
1118313275 14:64708271-64708293 CATTGAGTCTGGCTGGAAGCAGG - Intronic
1119616290 14:76101112-76101134 CAGTGATTCTGGGGAATAGTGGG - Intergenic
1119659139 14:76438076-76438098 CAGGCAGGCTGGGTAGAAGCTGG + Intronic
1119753740 14:77098906-77098928 TAGTGTTTCTGGGGAGAAGGTGG + Intronic
1120021586 14:79537092-79537114 TAGTGAGGCTGTGGAGAAGTAGG - Intronic
1121246650 14:92465581-92465603 CTGTCAGTCAAGGGAGAAGCCGG - Intronic
1122427982 14:101622767-101622789 AAGAGAATCTGGGGAGCAGCGGG + Intergenic
1122430022 14:101634738-101634760 GAGTGTGTCTGGGGACATGCTGG + Intergenic
1122788873 14:104176180-104176202 CAGCGAGTCGGGGCTGAAGCGGG - Exonic
1124103797 15:26718894-26718916 CAGCAAGTGTGGGGAGAGGCAGG - Intronic
1125602365 15:40922740-40922762 CAGGGAGTCTGCGGGGGAGCAGG + Intergenic
1125895941 15:43301829-43301851 CTGAGAGTCAGGGGAGAAGCTGG + Intronic
1126565194 15:50089629-50089651 TAGTGAGGCTGTGGAGAAACAGG + Intronic
1126688271 15:51267045-51267067 GAATGTGTCTGGGTAGAAGCAGG - Intronic
1126856203 15:52841784-52841806 CAGTGAATCTGGAGAGCAGCAGG + Intergenic
1126907900 15:53387079-53387101 CAGTGTGTTAAGGGAGAAGCAGG + Intergenic
1127175150 15:56346237-56346259 CAGAGAGGCAGGAGAGAAGCAGG + Intronic
1128525705 15:68410889-68410911 CTCTGACTCTGGGGAGAAGCAGG + Intronic
1128727496 15:69998896-69998918 CAGTGGGGCTGGGGAGTGGCAGG - Intergenic
1129115158 15:73361551-73361573 AAGTGAGTCTGTGCAGGAGCCGG + Intronic
1129680849 15:77657616-77657638 CAGCGAGCCTGGGGTAAAGCCGG + Intronic
1129699273 15:77758315-77758337 CAGTCAGTGAGGGGTGAAGCCGG - Intronic
1129705819 15:77793477-77793499 GAGTGTGTCTGGGGAGTGGCAGG - Intronic
1130989111 15:88865203-88865225 CAGGGACTCTGGGGAGCATCAGG - Intronic
1131225133 15:90618331-90618353 CAGTAATTCTGGACAGAAGCTGG - Intronic
1131459948 15:92610938-92610960 AAGTGAATCTGGGGAGGACCAGG - Intergenic
1131883020 15:96878554-96878576 CAGTGGTTCTCAGGAGAAGCTGG - Intergenic
1132556554 16:575241-575263 CTGTGATTGTGGAGAGAAGCAGG - Intronic
1132991779 16:2799123-2799145 AAGTGAGTCTGGGGGGCGGCCGG + Intergenic
1132991868 16:2799568-2799590 CAGTGAGGCTGGGGATAGACCGG + Intergenic
1133562046 16:6959549-6959571 CAGTGAGTCTGTGGCAAAGCAGG + Intronic
1133687807 16:8182827-8182849 CAGTGAGTCTGAAGTGAAGCGGG + Intergenic
1134469270 16:14508507-14508529 AAGTGAGTGTGGGGAAATGCAGG + Intronic
1135520464 16:23172938-23172960 CAGTGGGGCTGGGGAGGGGCTGG - Intergenic
1135619888 16:23946743-23946765 CAGTAGGTCTGGGGAGGGGCCGG + Intronic
1138419169 16:56888030-56888052 CAGTGAGTCGGGGGAGAGGAAGG + Exonic
1139374226 16:66486846-66486868 CAGTGAGTCAGGGCAGGTGCTGG + Intronic
1139426831 16:66885727-66885749 CAATGAGTATGGGGAGATGGAGG + Exonic
1140553296 16:75891390-75891412 TGGTGAGTCTGTGGAGAAACAGG - Intergenic
1140984218 16:80142279-80142301 CAGTGAGTGTGAGCCGAAGCAGG - Intergenic
1141102894 16:81210969-81210991 CAGTAAGTATGGGGTGCAGCTGG + Intergenic
1141453194 16:84119479-84119501 CAGTGAGTATAGCGAGAGGCTGG - Intergenic
1141472854 16:84251479-84251501 CATTGAGTCTGGGGAGGACAGGG + Intergenic
1141859937 16:86709670-86709692 CAGTGAAGCTGGAGAGAAGCAGG + Intergenic
1142502335 17:340060-340082 CAGTGGGTCTGGTGGGGAGCAGG - Intronic
1142507939 17:377233-377255 CAGAGAGAGTGGGGAGAAGAGGG + Intronic
1142649648 17:1339687-1339709 CAGTGAGGATGTGGAGTAGCTGG + Intergenic
1142903843 17:3029479-3029501 GGCTGAGTCTGGGGAGAGGCAGG + Intronic
1143488084 17:7266231-7266253 CAGTGAGTTTGGAGAGAAGCTGG - Intergenic
1143780815 17:9228375-9228397 CAGGGAGGCTGGAGAGAGGCTGG + Intronic
1143906767 17:10215496-10215518 CAGTAATTCTGGAGAGCAGCTGG - Intergenic
1144952322 17:19000888-19000910 CTGTGAGCCTGGGAAGCAGCTGG + Intronic
1147138616 17:38449303-38449325 CACTGGGTCTGGGGAGACCCTGG + Intronic
1148051383 17:44771668-44771690 CAGTGAGTATGGGGAGGGGCCGG + Exonic
1148331636 17:46817254-46817276 CAGGGAGTCTGGGGACCTGCAGG + Intronic
1149341884 17:55695271-55695293 CAGAGAATCAGTGGAGAAGCTGG - Intergenic
1149856565 17:60088101-60088123 CAGTGTGTGTGGGGAGGAGAGGG - Intergenic
1150272115 17:63873332-63873354 CCGGGAGCCTGGGGAGAAACCGG + Exonic
1150273470 17:63881512-63881534 CCGGGAGCCTGGGGAGAAACCGG + Exonic
1150275663 17:63896228-63896250 CCGGGAGCCTGGGGAGAAACCGG + Exonic
1150277795 17:63910917-63910939 CCGGGAGCCTGGGGAGAAACCGG + Exonic
1150816592 17:68396806-68396828 CAGATATTCTGGGGAGAAGCAGG - Intronic
1151462710 17:74264239-74264261 CAGTGAGCCTGCGGGGAGGCTGG - Intergenic
1151530344 17:74700294-74700316 AAGTGAGGCTGGAGTGAAGCAGG - Intronic
1151631763 17:75315826-75315848 CAGTGTGTCAGGGGAAAAGCTGG - Intergenic
1151734585 17:75931179-75931201 CAGTGTTTCTGGGGATAAGTAGG + Intronic
1152082595 17:78197656-78197678 TAGGGAGTCCGGGTAGAAGCTGG + Intronic
1152793979 17:82297958-82297980 CAGCGAGGCTGGGGAGGAGGAGG + Intergenic
1153376726 18:4388868-4388890 CAGTGAGGATGTGGAGAAACTGG + Intronic
1153453351 18:5254029-5254051 GAGTTAGTCTGGGGTGAAGCTGG - Intergenic
1153617956 18:6951654-6951676 CAGGGGGTCAGGGGTGAAGCGGG + Intronic
1153992745 18:10414614-10414636 CAGAGAAGCTGGGGAGAACCAGG - Intergenic
1154197442 18:12276913-12276935 CAGTGGGTCTGGCCAGGAGCAGG - Intronic
1155236082 18:23820822-23820844 CAGTCAGCCTGTAGAGAAGCTGG + Intronic
1157570170 18:48706976-48706998 CAGAGAGGTTGGGGAAAAGCAGG + Intronic
1158263778 18:55637405-55637427 CAGTGTACGTGGGGAGAAGCCGG - Intronic
1159217499 18:65413986-65414008 CAGTGTGTCTGGGAAGTAACTGG - Intergenic
1159566190 18:70053294-70053316 CATTGATTCTGGGGAGAAGAGGG - Intronic
1160251824 18:77210022-77210044 CAGGGAGGCTGTGGGGAAGCCGG + Intergenic
1160734116 19:654053-654075 CACTGACTCTGGGGAGAAGCGGG + Intronic
1160828364 19:1091146-1091168 CAGAGAGGCTGGGGAGGGGCGGG - Intronic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1162125598 19:8498202-8498224 CAGTGAGTGTGGGGAGGAAGCGG - Exonic
1163666349 19:18605832-18605854 CAGTGAGTCCGGGCACCAGCGGG - Intronic
1164230573 19:23284073-23284095 CCGTGAGACTGGGGAGATGCAGG + Intergenic
1164503772 19:28841376-28841398 CTGTGTGTGTGGGGAGAAGGTGG + Intergenic
1164676104 19:30102845-30102867 CTGTGAGGATGGTGAGAAGCTGG - Intergenic
1164975161 19:32567596-32567618 CAGTTAGTCTGGTGAATAGCAGG + Intergenic
1165331311 19:35142520-35142542 CCGTGAGTCTGGGGAGACTGCGG + Exonic
1166053291 19:40273931-40273953 CAGTGAGGCTGGAGAGCAGGCGG - Intronic
1166147049 19:40845098-40845120 CAAAGAGTCTGGAGAGATGCAGG + Intronic
1166151206 19:40876995-40877017 CAAAGAGTCTGGGGAGATGCAGG + Intronic
1166173363 19:41048054-41048076 CAGTGAAGCTGGGGAGGAGGTGG - Intergenic
1166179095 19:41094610-41094632 CAAAGAGTCTGGCGAGATGCAGG - Intronic
1166303472 19:41924828-41924850 CGGTGTTTCTGGAGAGAAGCAGG + Intronic
1166328854 19:42067323-42067345 CAGTGAGTCAGGGGCAGAGCTGG - Intronic
1166531356 19:43545463-43545485 CTGTTGGTCTGGGGTGAAGCCGG - Intronic
1167029168 19:46945713-46945735 AAGTGAGGCTGAGGAGAGGCTGG - Intronic
1167608537 19:50494701-50494723 CAGAGAGGAGGGGGAGAAGCTGG + Intergenic
925189550 2:1871658-1871680 CTGAGAGCCTGGGGAGCAGCTGG - Intronic
926272475 2:11377081-11377103 CAGAGCCTCTGGGGAGAGGCAGG + Intergenic
926772744 2:16392845-16392867 CAGGGACTCTGGGAAGAATCTGG - Intergenic
927017838 2:18985155-18985177 CGGTGAGTATGTGGAGAAACTGG - Intergenic
927784658 2:25965299-25965321 GGGTGAGACTGGGGAGAAGGAGG - Intronic
927868470 2:26608261-26608283 GAGTGGGTCTGGTGAGAAGGGGG + Intronic
928423343 2:31157225-31157247 CAGTTGGTCTTGGGAGAAGTCGG - Intergenic
928922374 2:36539136-36539158 CAGAGAGGCTGGGGAGAAGTGGG + Intronic
928951324 2:36815691-36815713 AGGTGAGTCTTTGGAGAAGCTGG - Intergenic
929120071 2:38477068-38477090 GAGGGAGTCAGGGAAGAAGCTGG + Intergenic
929191773 2:39146925-39146947 CAGTGGGACTGGGGGAAAGCAGG - Intergenic
929266969 2:39929135-39929157 CTGTGCTTCTGGGGAAAAGCGGG - Intergenic
929910113 2:46082618-46082640 CAGTGAGGATGGGGAGCATCTGG + Intronic
929927916 2:46230661-46230683 CAGTTAGTCAGGGATGAAGCTGG + Intergenic
930716197 2:54596190-54596212 CAGACAGTCTGAGGAGGAGCAGG - Intronic
930867468 2:56136015-56136037 CAGGGAGTTTGGGGAGCAGTGGG + Intergenic
931669729 2:64636467-64636489 CAGTGAGGCCGGGGTGAGGCAGG + Exonic
932356064 2:71069093-71069115 GAGTGGGAGTGGGGAGAAGCGGG + Intronic
932357209 2:71076641-71076663 CAGGAAGGCTGGGGAGATGCTGG + Exonic
932573699 2:72951347-72951369 CCGGGAGGCTGGGGAGACGCTGG - Intronic
932776387 2:74530424-74530446 TACTGACTCCGGGGAGAAGCGGG - Exonic
932840075 2:75073652-75073674 CAGTGGGTCTGGGGGGAGGTGGG + Intronic
933176839 2:79183881-79183903 CAGTGATTGGGGGGAGAAGGAGG - Intergenic
933264507 2:80168047-80168069 CAGTGCCTTGGGGGAGAAGCAGG + Intronic
934067067 2:88350467-88350489 CAGTGGGTCTGGGGAGGAGGAGG + Intergenic
934575928 2:95401652-95401674 CAGCGGGTCTGGGGAGAGGATGG - Intergenic
934606586 2:95699802-95699824 CAGTGCATCCTGGGAGAAGCAGG - Intergenic
934778379 2:96953383-96953405 CAGGGACTCTGAGGAGACGCTGG + Intronic
935085728 2:99842800-99842822 CACAGAATATGGGGAGAAGCAGG + Intronic
935107541 2:100059457-100059479 TAGTGAGGCTGTGGAGAAACTGG + Intronic
935182813 2:100705449-100705471 CAGTTACTGTGGGGAGAAGGAGG + Intergenic
935263713 2:101376668-101376690 CTGTGAGTCTTGTGAGAAGCTGG - Intronic
935737659 2:106119306-106119328 CAGGGAGTGTGGGGAGGAGCAGG + Intronic
936067088 2:109340487-109340509 CAGTGAATATGGGCAGATGCTGG + Intronic
936539990 2:113341930-113341952 CAGTGCATCCTGGGAGAAGCAGG - Intergenic
937203387 2:120220393-120220415 CAGGGAATCAGGGCAGAAGCTGG - Intergenic
937684683 2:124682344-124682366 CAGCTGGTTTGGGGAGAAGCAGG - Intronic
937885224 2:126894939-126894961 CACTGAAACAGGGGAGAAGCTGG + Intergenic
938191444 2:129285414-129285436 TGGTGAGAATGGGGAGAAGCTGG - Intergenic
938673136 2:133603995-133604017 CTGTGAGTCCTGGGAGAGGCAGG + Intergenic
939398804 2:141665437-141665459 TGGTGAGTCTGTGGAGAAGTTGG + Intronic
939661435 2:144895516-144895538 CACGGAGCCTGGGGAGAAGTGGG - Intergenic
941052311 2:160748829-160748851 CCCTGAGTCAGGGAAGAAGCAGG + Intergenic
942152073 2:173086617-173086639 CAGTGATTCTGTGAAGAACCTGG + Intronic
943016021 2:182511736-182511758 CAAGGACTCTGGGGAGAGGCTGG - Intronic
943088751 2:183349221-183349243 CAGAGAGCCTGGAGGGAAGCGGG - Intergenic
943593337 2:189825929-189825951 CAGTTAATCTGGGAAGATGCAGG + Intronic
945181931 2:207100792-207100814 TAATGTGTGTGGGGAGAAGCAGG - Intronic
946482294 2:220068845-220068867 CTGTAAGTCTGGGGAGAACAGGG - Intergenic
947040253 2:225910419-225910441 CTGTATCTCTGGGGAGAAGCAGG - Intergenic
947564625 2:231185948-231185970 CAGGGAGGCTGGGAAGAAGCTGG + Intergenic
947665962 2:231905370-231905392 CAGGGAGTCTGGGCACAACCTGG + Intergenic
947756691 2:232571135-232571157 CAGTGTGACTGGGGAAAGGCTGG - Intronic
948261395 2:236606893-236606915 CAGTGGATCTGGGGTGAGGCTGG - Intergenic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948369106 2:237475986-237476008 CAGTGAGTCAGGGGTGGAGTAGG - Intergenic
1168907216 20:1416108-1416130 CAATGAGTCAGGGGAGCTGCAGG - Intergenic
1170673499 20:18457030-18457052 CAGCAAGTATGTGGAGAAGCTGG - Intronic
1170881961 20:20304729-20304751 CAGTGAGGGTGTGGAGAAGTGGG + Intronic
1171022394 20:21597856-21597878 CAGTGAGTCTGGGGGTAAATAGG + Intergenic
1171311999 20:24152041-24152063 CAGTGACAGTGGGGAGAGGCGGG + Intergenic
1172865898 20:38097045-38097067 CAGTGAGGATGTGGAGAAACTGG - Intronic
1172872063 20:38142086-38142108 CAATGAGTTTGGGGAGATCCAGG - Exonic
1173246548 20:41341255-41341277 CAGTCAGGCTGGGGTAAAGCTGG - Intronic
1173523578 20:43716200-43716222 CTGAGAGTCTGGGGAGGGGCTGG - Exonic
1173729327 20:45317606-45317628 GAGAGAGTCTCGGGAGGAGCAGG - Exonic
1173788856 20:45814494-45814516 GAGTGAGTCTGGGGAAAGGTGGG + Intronic
1173986145 20:47263081-47263103 AAATGAGGCAGGGGAGAAGCAGG - Intronic
1174406871 20:50308662-50308684 CAGTGAGGCTGGGGAGGTGGCGG + Intergenic
1174926826 20:54769547-54769569 CAGGCAGGATGGGGAGAAGCAGG + Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175293383 20:57893080-57893102 CAGCACCTCTGGGGAGAAGCTGG + Intergenic
1175485672 20:59344254-59344276 TTGTGAGTCTGGGGGTAAGCAGG - Intergenic
1175867985 20:62191580-62191602 GAGTGAGGCTGGGGAGAGGGAGG + Intronic
1176023308 20:62973487-62973509 CAGTGGGCTTGGGGAGAAGCCGG - Intergenic
1178285487 21:31322251-31322273 CAAGGAGACTTGGGAGAAGCTGG - Intronic
1178940354 21:36900421-36900443 GAGTGAGCCTGGGCAGAAGGTGG + Intronic
1179138037 21:38697834-38697856 CAGTGAGGCTCTGGAGTAGCTGG - Intergenic
1179514483 21:41897382-41897404 CAGTGAGTGCTGGGCGAAGCGGG - Intronic
1179712669 21:43272360-43272382 CAGTGAGCCTGGAGGGAGGCAGG + Intergenic
1179728117 21:43351766-43351788 CAGTTAGTTTGGGGAGGAGTAGG - Intergenic
1181444355 22:22957295-22957317 CAGAGAGTGTGAGCAGAAGCTGG - Intergenic
1181730619 22:24843658-24843680 CAATGACTCTGGGCAGAATCAGG + Intronic
1181830958 22:25559776-25559798 CGGTGAGTCTGGGGTGAGTCTGG - Intergenic
1182074453 22:27485824-27485846 CAATGAGCCTGTGGGGAAGCAGG - Intergenic
1183341273 22:37283253-37283275 CAATGTGTCTGGGGAGAAAGAGG + Intronic
1183661045 22:39221450-39221472 CTCTGAGATTGGGGAGAAGCAGG + Intergenic
1183834430 22:40440599-40440621 CAGTTCATCTGGGGAGAGGCTGG + Intronic
1184333817 22:43841662-43841684 CAGATAGCCAGGGGAGAAGCTGG - Intronic
1184568618 22:45308725-45308747 CAGTGACTCTGGGATGAAGAGGG - Intergenic
1184733677 22:46385463-46385485 CAGTGAGCCTGGAGTGAGGCGGG + Intronic
1185289780 22:50017500-50017522 CAGTAAGTCGGGGCAGAGGCTGG + Intronic
949466451 3:4349342-4349364 TAGTGAGGCTGTGGAGAAGTAGG + Intronic
949537836 3:5009649-5009671 CAGGGACTCTGGGGACAGGCAGG + Intergenic
949834530 3:8253740-8253762 CAGTAAGTCTGGGGTGGGGCTGG - Intergenic
950194278 3:10998300-10998322 CTGTGAGGCTGGGGAGAAAAGGG + Intronic
950262714 3:11554159-11554181 CAGTGAACCTGGGGAGCAGGAGG - Intronic
950262938 3:11555202-11555224 CAGTGGCTCTGGGCAGGAGCTGG - Exonic
950435372 3:12976232-12976254 GAGTGACACTGGGGAAAAGCAGG + Intronic
950560529 3:13718788-13718810 GACTGAGACTGGGGAGACGCCGG - Intergenic
952175609 3:30859224-30859246 CTGGGAGGCTGGGGGGAAGCAGG + Intronic
953909917 3:46886804-46886826 CAGTGAGTCTGTGGCACAGCAGG + Intronic
954042540 3:47899865-47899887 CTGTGTGTCTGGGCAGAAGGTGG + Intronic
954794114 3:53152853-53152875 CAGTGAGCCTGCGGAGACGCTGG - Intergenic
956737616 3:72250185-72250207 GAAAGAGTATGGGGAGAAGCAGG + Intergenic
958624560 3:96607309-96607331 CAGTGAGCATGGGCTGAAGCAGG - Intergenic
958743194 3:98099676-98099698 CAATGGGTCTGGAGAGAAACTGG + Intergenic
961142529 3:124567305-124567327 CAGGGAGTCTGTGGCCAAGCTGG + Intronic
961514836 3:127426027-127426049 CAGTGAGTCCTGGGGGAAGCTGG + Intergenic
961534512 3:127561644-127561666 CAGCCAGCCTGGGGAGCAGCTGG - Intergenic
961878277 3:130041380-130041402 CATTGAATCTGGTGTGAAGCTGG + Intergenic
962132754 3:132699223-132699245 CAGTGAGGATGGGGAGAAGTGGG - Intronic
962509182 3:136081710-136081732 CAGTGAGTCAGGGAAGACCCAGG + Intronic
962834407 3:139174342-139174364 TAGTGAGTGTGGGGAGAGACAGG - Intronic
962906104 3:139804450-139804472 CAATGACTCTGGGAAGAACCTGG + Intergenic
964477396 3:157109493-157109515 CAGTGAGTGTGGGCAGATGGAGG + Intergenic
965061638 3:163791420-163791442 CATTGTGTCTGGGGACAAGCAGG + Intergenic
965382509 3:168007313-168007335 TAGTGAGTATGGAGAGAAGTGGG + Intergenic
966007339 3:175031751-175031773 CAGTGAGGCTGGAGAGAAAAAGG - Intronic
966990944 3:185229465-185229487 CAGTGAGTCTGGGGAGAAGCTGG + Exonic
967986780 3:195101075-195101097 CAGTGAGGCTGGGGAGCTGCTGG - Intronic
968577165 4:1372895-1372917 CAGTGAGTGTGTAGAGACGCGGG - Intronic
968726525 4:2250445-2250467 CAGTGGGCCTGTGGAGAGGCTGG + Exonic
968867056 4:3219904-3219926 CAGGGAGTGCTGGGAGAAGCAGG - Intronic
969145079 4:5115506-5115528 AAGTGTGTCTGGGGCAAAGCTGG + Intronic
969219688 4:5751746-5751768 CAGTGAGGGTGGGGACAAGCAGG + Intronic
969310018 4:6347642-6347664 CAGGGACTCTGGGGGGCAGCAGG + Intronic
969463319 4:7340309-7340331 CAGGGAGACTGGGTAGGAGCTGG + Intronic
969518373 4:7661423-7661445 CAGGGAGTGTGGGGAGCAGCTGG + Intronic
970444584 4:16113028-16113050 CAGTGAGGCTGGGAGGAAACAGG + Intergenic
971279771 4:25233825-25233847 CCGTGAGCGCGGGGAGAAGCTGG - Intronic
975514355 4:75229521-75229543 CAGAGAGTCTGGGGAGACCAAGG - Intergenic
975884259 4:78945461-78945483 CAGTGAGACTGTGGAGAAATGGG - Intergenic
975991865 4:80266472-80266494 GAGTGAGTGGGAGGAGAAGCTGG - Intergenic
976831057 4:89314424-89314446 CAGTAAGGCTGGGGAAAAGAGGG + Intergenic
977766887 4:100809116-100809138 CAGTGAGTGTGGGAAGAAAATGG + Intronic
978203386 4:106049588-106049610 CAGTGGGACAGGGGAGAACCAGG + Intronic
978745179 4:112185396-112185418 CAGTAAGTCAGGGGTGAAGTTGG - Intronic
980623699 4:135344503-135344525 CAATGGGACTGGGGAGTAGCTGG + Intergenic
982178781 4:152730958-152730980 CAGTGAATGAGGGGAGAAGTTGG + Intronic
983189505 4:164740113-164740135 CTGTGGCTCTAGGGAGAAGCTGG - Intergenic
984517776 4:180761798-180761820 CAGTTTGTCTGATGAGAAGCTGG - Intergenic
984704902 4:182840470-182840492 GGGTGATTCTGGTGAGAAGCTGG - Intergenic
985966803 5:3343842-3343864 CTGGGAGACTGGGAAGAAGCAGG + Intergenic
986019019 5:3783692-3783714 CAGTGGGTCTGCTGAGAAGCAGG + Intergenic
986317968 5:6603820-6603842 CAGAGAGTCCGGGGAGAGGAGGG - Intronic
986442519 5:7794438-7794460 CAGTGAGTGTGGGGAGATTCTGG + Intronic
987053398 5:14167223-14167245 CAGTAACTCTGGGGGGAAGATGG + Intronic
987210685 5:15679032-15679054 CAGAGAGTCTGCAGAAAAGCTGG - Intronic
987452312 5:18101301-18101323 CAGTGAATCTAGGGAAATGCAGG + Intergenic
988802613 5:34710669-34710691 CAGTAGGTCTGGGTAGAACCAGG + Intronic
988918489 5:35919858-35919880 CAGTGGGTATGGGGTGAAGATGG + Intronic
989632619 5:43501561-43501583 CAGGGAGTGGAGGGAGAAGCAGG + Intronic
990387163 5:55276977-55276999 CAGTGAGTCAGCAGAGGAGCTGG - Intronic
990705878 5:58528878-58528900 CATTGAGGCTGGTGAGAAGCTGG + Intergenic
991337783 5:65568661-65568683 CAGTGAGTATGGGAAGTAGGTGG + Intronic
991352772 5:65735782-65735804 CACTGAGTGAGAGGAGAAGCTGG - Intronic
992102025 5:73417384-73417406 CTGTCAGGCTGGGGAGGAGCTGG - Intergenic
992891272 5:81206556-81206578 CAGTGAGTCTGAGGGTGAGCTGG - Intronic
993119057 5:83753410-83753432 CAGAGAGGGTGAGGAGAAGCAGG + Intergenic
993616194 5:90115336-90115358 CAGAGTGTTTGGGGATAAGCAGG + Intergenic
995562510 5:113398192-113398214 CAGTGAGGCTGTGGAGAAAGGGG + Intronic
997395230 5:133554248-133554270 CAGAGAGCCTGGGGAGATGGGGG + Intronic
997772141 5:136565121-136565143 TAGTGAGGCTGTGGAGAAGAGGG - Intergenic
998403043 5:141858049-141858071 CAGTGAGACAGGTGAGGAGCTGG - Intronic
998483135 5:142479576-142479598 CATAGAGACTGAGGAGAAGCAGG + Intergenic
998808240 5:145939522-145939544 CAATGAGGGTGGGAAGAAGCAGG + Intronic
999286981 5:150399953-150399975 CAGTGAGCCTGCGGGGAGGCTGG + Exonic
1000824774 5:166031573-166031595 CAGTGAATCTGGGGGGAATGAGG - Intergenic
1000896801 5:166865176-166865198 TTGAGAGTCAGGGGAGAAGCAGG + Intergenic
1001307372 5:170585334-170585356 CAGTGAGTTAGGGGATGAGCCGG + Intronic
1001549695 5:172594004-172594026 GGGTGAGTCAGAGGAGAAGCAGG + Intergenic
1001893403 5:175358426-175358448 AAGTGGGTCTGGGGACAATCTGG - Intergenic
1002097551 5:176840359-176840381 CTGTGAGTCGGGGGAGGGGCTGG + Intronic
1002240736 5:177837583-177837605 CAGTGACTCAGGGAAGCAGCAGG - Intergenic
1002342078 5:178523803-178523825 CAGTGATTCTTGGGAGAACAAGG - Intronic
1002470613 5:179433159-179433181 CAGTGAGCCAGGAGAGAGGCCGG - Intergenic
1003693670 6:8380062-8380084 GGGTGAGGCTGGGGAGAAGTTGG + Intergenic
1004320648 6:14628927-14628949 TAGGGAGTCTGGGGTGAAGCTGG + Intergenic
1004407844 6:15351300-15351322 GAGTGAGTGAGGGGAAAAGCTGG + Intronic
1005234527 6:23744506-23744528 TGGTGAGGCTGTGGAGAAGCAGG + Intergenic
1005332616 6:24764418-24764440 CAGGGAGACTGTGGAGAAGGAGG - Intergenic
1005826377 6:29633449-29633471 CAGGGAGTCTGGGATGAAGGTGG + Intronic
1007083929 6:39129392-39129414 CAGTGACTCTGATGAGGAGCTGG + Intergenic
1007135528 6:39517588-39517610 CAATGAGTCTGGGGATAATGAGG + Intronic
1007248029 6:40476392-40476414 CAGTGAGGTTGGGGAGACACAGG - Intronic
1007262680 6:40574923-40574945 AAGTGTGTTTTGGGAGAAGCAGG - Intronic
1007679381 6:43624022-43624044 CAGTGTGTCTGGAGAGAGTCTGG - Exonic
1007733361 6:43965276-43965298 AAGTCAGTCTGGGGTGAACCAGG - Intergenic
1008637635 6:53427018-53427040 CAGTGAGGCAGGGGAGAGGTGGG + Intergenic
1009729641 6:67583602-67583624 TAGTGAGGCTGTGGAGAAGAGGG - Intergenic
1009962618 6:70542035-70542057 AAGTGAGAATGGGGAGAAGGGGG - Intronic
1011040053 6:83019950-83019972 GAGGAAGTCTGTGGAGAAGCGGG + Intronic
1011519531 6:88189822-88189844 CAGTGAGAATGTGGAGCAGCAGG - Intergenic
1012918438 6:105196232-105196254 AAGTGAGTCAGGGGAAAGGCTGG - Intergenic
1012996819 6:105982758-105982780 CAGGGAGCCAGGGGAGAAGGTGG + Intergenic
1013658497 6:112270384-112270406 CAGTGTGTCTGGTGGGCAGCTGG + Intergenic
1015374095 6:132490704-132490726 GAGTGAGAATGGGCAGAAGCAGG + Intronic
1015798865 6:137040861-137040883 GTGTGAGTTTGGGGATAAGCAGG + Intronic
1015835840 6:137419094-137419116 CAGAGAGGCTGAGAAGAAGCTGG + Intergenic
1016017394 6:139200137-139200159 CAGGGAGCCTGAGGAAAAGCTGG - Intergenic
1017277055 6:152581748-152581770 CAGTGAGTCTGGAGCGAGCCAGG - Intronic
1017809819 6:157976813-157976835 CAGCGAGGTTGGGGAGAAGAAGG + Intergenic
1018005293 6:159616624-159616646 CAGTGAGTCTGGGTAGCAGATGG + Intergenic
1018833927 6:167469304-167469326 CAGGAAGTCTGGGGTGAGGCAGG + Intergenic
1019011703 6:168848329-168848351 CAGAGATTCCGGGGAGAAACAGG + Intergenic
1019493112 7:1324227-1324249 GAGTGAGGCTGTGGACAAGCTGG - Intergenic
1019841574 7:3451295-3451317 CACTGAGTCTGGAGAGAGGAAGG + Intronic
1019908132 7:4080181-4080203 GAGTGAGTCTGGGGAGAGCTGGG + Intronic
1021031825 7:15746624-15746646 CAGTGAGGATGTGGAGAAACAGG + Intergenic
1022042324 7:26592798-26592820 CATTCAGTCTGAGGAGAAGGGGG - Intergenic
1022530477 7:31063822-31063844 CAGTGAGTCAGGCCAGAGGCAGG - Intronic
1022537931 7:31109528-31109550 AAGTGGGGCTGGGGAGAAGCAGG + Exonic
1023033870 7:36113577-36113599 GAGTGCCTCTGGGGAGAAGACGG - Intergenic
1023929435 7:44696338-44696360 ACGTGATTTTGGGGAGAAGCAGG - Intronic
1023994156 7:45148625-45148647 CGGTGAGTTTGGGGAATAGCAGG - Intergenic
1024122283 7:46256919-46256941 CACTCAGGCTGGGGAGAACCTGG + Intergenic
1024234242 7:47385815-47385837 CAGTGAGTCTGGGATGCTGCTGG - Intronic
1026253202 7:68688879-68688901 CAGTCAGTTTGGAGAGATGCTGG - Intergenic
1027517487 7:79160853-79160875 CAGTAAGTCTGGGGCTAAGGGGG + Intronic
1028999524 7:97138858-97138880 CAGTGAGCCTGGGCACAAGCAGG - Intronic
1030265214 7:107614118-107614140 CAGTCTGTCTTGGGAGAAACTGG - Intronic
1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG + Intronic
1031984387 7:128153806-128153828 CAGTGATGCAGGGGAGAAGCGGG - Intergenic
1033197595 7:139341053-139341075 CGCTGAGTCTCAGGAGAAGCGGG - Intronic
1033298716 7:140165762-140165784 CAGTGAGGCTGGTGTGATGCTGG + Intronic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1033537892 7:142328843-142328865 CACTGAGTCTGGGGTGAGGGAGG - Intergenic
1033609849 7:142954536-142954558 AAGAGAGACTGGAGAGAAGCAGG + Intronic
1033631862 7:143166175-143166197 CACTGAGTGTGAGGTGAAGCAGG - Intergenic
1034323577 7:150208226-150208248 CTGAGAGTCTGGGGAGAACAAGG + Intergenic
1034415341 7:150961686-150961708 CTGTGAGTCAAGGTAGAAGCCGG + Intronic
1034586414 7:152097360-152097382 CAGTGAGGATGTGGAGAAACTGG + Intronic
1034769617 7:153760961-153760983 CTGAGAGTCTGGGGAGAACAAGG - Intergenic
1035675579 8:1453258-1453280 CGGTCAGGCTGGGGAGAAGCAGG + Intergenic
1036285893 8:7443889-7443911 CAGTGGGTATTGGGAGAAGCCGG - Intronic
1036335580 8:7867640-7867662 CAGTGGGTATTGGGAGAAGCCGG + Intronic
1037178349 8:15973612-15973634 CAGTGAGTAAGGGGAGGAGAGGG + Intergenic
1037659783 8:20916616-20916638 CAGTGGGTATGGGGGGAAACTGG + Intergenic
1037718699 8:21422322-21422344 CAGTGCATCTGGGGATAAGAGGG + Intergenic
1038318545 8:26508330-26508352 CAGTAATTCTGGTGAGATGCAGG + Exonic
1038400431 8:27280303-27280325 CAGGGGGTGTGGGGAGAAGTGGG - Intergenic
1039821396 8:41138472-41138494 CAGTGATACAGGAGAGAAGCTGG - Intergenic
1040602435 8:48897741-48897763 CAGTGATTCTGGAGGGAGGCAGG - Intergenic
1040604048 8:48912213-48912235 CAGTGGGGCTGGGAAGCAGCTGG - Intergenic
1040975589 8:53190929-53190951 CAGCAAGTGTGGGAAGAAGCGGG - Intergenic
1041508865 8:58632524-58632546 CAGTGAGGTTGGAGAGAAGCAGG - Intronic
1046057213 8:109093352-109093374 GAGTGAGGCAGGGGAGAAGACGG - Intronic
1046176951 8:110588697-110588719 GAGTGACTCTGGGGAGAAATTGG - Intergenic
1046351822 8:113025319-113025341 CTTTGATTCTGGGTAGAAGCAGG + Intronic
1048176113 8:132154242-132154264 CAGTTTGTATGGGGAGAAGGGGG - Intronic
1048196409 8:132335401-132335423 CAGTGAGACTGGAGAGAAGTTGG - Intronic
1048265090 8:132978653-132978675 AAGTGACTCTGGGGGAAAGCTGG + Intronic
1048510179 8:135055004-135055026 CGGTGGGGCTGGGGGGAAGCTGG - Intergenic
1049155216 8:141062124-141062146 CAGGGAGTGAGGGGACAAGCAGG - Intergenic
1049291055 8:141802174-141802196 GAGTTAGGCTGGGCAGAAGCAGG + Intergenic
1049509574 8:143020734-143020756 GAGTGGGTCAGGAGAGAAGCAGG + Intronic
1050197816 9:3106926-3106948 CAGTCTGTCTGGAGTGAAGCAGG - Intergenic
1050885252 9:10756513-10756535 CAGTGAGGCTGTGGAGAAAAGGG + Intergenic
1051000686 9:12278674-12278696 CAGTGACTGAGGGGAGAAGATGG - Intergenic
1051765252 9:20515578-20515600 CGGTGAGTATGGGGAGAAAAAGG - Intronic
1053092044 9:35287467-35287489 CAGTGAGGCTGTGGAGCAACTGG - Intronic
1053564335 9:39232579-39232601 CAGTGAGTCAGAGGAAGAGCAGG - Intronic
1053830121 9:42070480-42070502 CAGTGAGTCAGAGGAAGAGCAGG - Intronic
1054132815 9:61386457-61386479 CAGTGAGTCAGAGGAAGAGCAGG + Intergenic
1054600437 9:67116972-67116994 CAGTGAGTCAGAGGAAGAGCAGG + Intergenic
1054821565 9:69526577-69526599 CAGTGAGGCTGTGGAGAAAAGGG + Intronic
1055560225 9:77515011-77515033 CAGTGAGGCCTGGGAGAAGCAGG + Intronic
1056010959 9:82329604-82329626 CAGTCATGCTGGGGAGAAGGGGG + Intergenic
1056267196 9:84909565-84909587 CAGTGAGGATGTGGAGAAACAGG - Intronic
1057204661 9:93164091-93164113 CAGAGTGTCCAGGGAGAAGCTGG - Intergenic
1057307584 9:93921118-93921140 CAAGGATTCTGGGGAGCAGCGGG + Intergenic
1057598048 9:96433413-96433435 CAGAGAGGCTGGTCAGAAGCTGG + Intergenic
1057787319 9:98096709-98096731 CAGTGGGGATGGGGAGAAACAGG - Intronic
1058285001 9:103166664-103166686 CAGTGAGGATGTGGAGAAGTGGG - Intergenic
1058774985 9:108274167-108274189 CAGTGCATCTGAGGAGAGGCTGG - Intergenic
1059531085 9:115036344-115036366 CAGTGACCCTGCGGAAAAGCAGG + Intronic
1060231344 9:121827592-121827614 CAGTGAGTGTGGGGGGACGCGGG + Intronic
1060521642 9:124297457-124297479 CAGTGAGGCTGGCGGGGAGCTGG - Intronic
1060896101 9:127218627-127218649 CCGTGAGTCTGGGAATGAGCAGG - Intronic
1061398470 9:130355853-130355875 CAGTGAGTCTGGGGTGGTGGAGG + Intronic
1062286967 9:135777695-135777717 GAGTGGGTGTGGGGAGGAGCTGG - Intronic
1062295814 9:135825936-135825958 CAGGGAGCCCGGGGGGAAGCTGG + Intronic
1186442082 X:9595133-9595155 CTGGGAGCCTGGGGAGGAGCCGG - Intronic
1186580394 X:10811468-10811490 CAGTGTGTAAGTGGAGAAGCTGG + Intronic
1187344365 X:18449499-18449521 CAGTGATTCTGGGGGGCGGCAGG - Intronic
1189865173 X:45320383-45320405 CAATGGCTGTGGGGAGAAGCAGG + Intergenic
1190472818 X:50799986-50800008 CAGGCAGCCTGGGGACAAGCAGG + Intronic
1191852343 X:65594702-65594724 CAGTGAATCAGGAGAGAAGTAGG + Intronic
1191955360 X:66638207-66638229 CAGTGAGTCTGCGGAGTTGAAGG + Intronic
1192491419 X:71579543-71579565 CAGTGGCTGTGGGGAGAAGTGGG + Intronic
1192910857 X:75602464-75602486 CAGTGAGTGTGAGCCGAAGCAGG - Intergenic
1192925682 X:75752702-75752724 TAGTGAGTCTGGGCTGAATCTGG - Intergenic
1194209670 X:91056506-91056528 TAGTGAGGCTGTGGAGAAACAGG + Intergenic
1195079566 X:101358166-101358188 CTGTGATACTGGGTAGAAGCTGG - Intronic
1195422848 X:104694815-104694837 CAATTAGTTTGGGGAAAAGCAGG - Intronic
1196218555 X:113084695-113084717 TAGTGAGGCTGTGGAGAAGAGGG - Intergenic
1196843007 X:119875872-119875894 CAGTGAGTCAGAGGACAAGAAGG - Intronic
1197106325 X:122720800-122720822 CAGTGAGTCAGCTGACAAGCTGG + Intergenic
1197312152 X:124918062-124918084 CAGGGAGTCTGGGTAGAAAAAGG - Intronic
1197893768 X:131289472-131289494 CAGGGAGTCCGGAGAGAGGCGGG - Intronic
1198283906 X:135171280-135171302 CACAGTGTCTGAGGAGAAGCAGG - Exonic
1199144600 X:144350173-144350195 CAATGAGTCTGGGGACACACTGG + Intergenic
1199968677 X:152842346-152842368 CAGTGAGGATGTGGAGAACCTGG - Intronic